Multiple sequence alignment - TraesCS2B01G008800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G008800 chr2B 100.000 2564 0 0 1 2564 4925189 4922626 0.000000e+00 4735
1 TraesCS2B01G008800 chr2B 84.142 309 30 4 813 1121 123187633 123187344 5.400000e-72 281
2 TraesCS2B01G008800 chr2B 90.604 149 11 3 1190 1337 116839835 116839981 7.240000e-46 195
3 TraesCS2B01G008800 chr7A 98.880 2053 19 2 512 2564 191836341 191838389 0.000000e+00 3661
4 TraesCS2B01G008800 chr7A 97.903 2051 40 2 514 2564 736109177 736107130 0.000000e+00 3546
5 TraesCS2B01G008800 chr7A 92.742 124 9 0 514 637 220547093 220546970 2.030000e-41 180
6 TraesCS2B01G008800 chr6A 98.831 2053 23 1 512 2564 565045636 565047687 0.000000e+00 3657
7 TraesCS2B01G008800 chr6B 98.051 2052 39 1 513 2564 558911417 558913467 0.000000e+00 3567
8 TraesCS2B01G008800 chr6B 94.284 2047 112 5 518 2564 94336557 94334516 0.000000e+00 3127
9 TraesCS2B01G008800 chr6B 81.452 248 20 12 1315 1559 660363864 660364088 2.030000e-41 180
10 TraesCS2B01G008800 chr6B 78.829 222 26 5 1108 1309 660282436 660282656 5.760000e-27 132
11 TraesCS2B01G008800 chr3A 93.984 1230 65 5 1343 2564 472399762 472400990 0.000000e+00 1853
12 TraesCS2B01G008800 chr3A 87.739 995 87 18 1589 2563 675308201 675307222 0.000000e+00 1129
13 TraesCS2B01G008800 chr3A 88.796 598 49 11 514 1111 472399190 472399769 0.000000e+00 717
14 TraesCS2B01G008800 chrUn 87.864 997 87 18 1589 2564 291127426 291128409 0.000000e+00 1140
15 TraesCS2B01G008800 chrUn 97.943 389 8 0 683 1071 479724651 479724263 0.000000e+00 675
16 TraesCS2B01G008800 chr4A 87.538 995 87 20 1589 2563 306975477 306974500 0.000000e+00 1116
17 TraesCS2B01G008800 chr4A 85.283 530 57 5 4 515 159733547 159734073 6.280000e-146 527
18 TraesCS2B01G008800 chr4A 89.474 228 20 3 1112 1337 728978543 728978318 4.180000e-73 285
19 TraesCS2B01G008800 chr2D 87.349 996 87 14 1589 2564 348613004 348612028 0.000000e+00 1105
20 TraesCS2B01G008800 chr2D 90.086 232 22 1 1112 1343 434934387 434934157 1.490000e-77 300
21 TraesCS2B01G008800 chr3B 97.661 513 11 1 4 515 793754206 793753694 0.000000e+00 880
22 TraesCS2B01G008800 chr3B 86.026 229 31 1 1316 1544 1586161 1586388 7.090000e-61 244
23 TraesCS2B01G008800 chr3B 91.852 135 10 1 513 646 603624731 603624865 1.210000e-43 187
24 TraesCS2B01G008800 chr4B 87.103 535 51 9 5 523 168957030 168957562 7.900000e-165 590
25 TraesCS2B01G008800 chr3D 87.121 528 48 8 4 515 68376832 68377355 4.760000e-162 580
26 TraesCS2B01G008800 chr3D 86.553 528 50 9 4 515 68379774 68380296 1.720000e-156 562
27 TraesCS2B01G008800 chr3D 89.969 319 30 2 4 322 68354843 68355159 6.600000e-111 411
28 TraesCS2B01G008800 chr3D 91.791 268 22 0 4 271 68382713 68382980 8.660000e-100 374
29 TraesCS2B01G008800 chr3D 84.314 255 19 9 278 515 68385726 68385976 1.980000e-56 230
30 TraesCS2B01G008800 chr2A 84.986 353 50 3 1108 1459 702472233 702472583 3.140000e-94 355
31 TraesCS2B01G008800 chr1D 85.207 338 45 5 524 860 356006108 356006441 2.440000e-90 342
32 TraesCS2B01G008800 chr1B 85.855 304 25 3 802 1105 92539363 92539078 8.910000e-80 307
33 TraesCS2B01G008800 chr5A 89.677 155 14 2 253 406 179926998 179927151 2.010000e-46 196


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G008800 chr2B 4922626 4925189 2563 True 4735.0 4735 100.00000 1 2564 1 chr2B.!!$R1 2563
1 TraesCS2B01G008800 chr7A 191836341 191838389 2048 False 3661.0 3661 98.88000 512 2564 1 chr7A.!!$F1 2052
2 TraesCS2B01G008800 chr7A 736107130 736109177 2047 True 3546.0 3546 97.90300 514 2564 1 chr7A.!!$R2 2050
3 TraesCS2B01G008800 chr6A 565045636 565047687 2051 False 3657.0 3657 98.83100 512 2564 1 chr6A.!!$F1 2052
4 TraesCS2B01G008800 chr6B 558911417 558913467 2050 False 3567.0 3567 98.05100 513 2564 1 chr6B.!!$F1 2051
5 TraesCS2B01G008800 chr6B 94334516 94336557 2041 True 3127.0 3127 94.28400 518 2564 1 chr6B.!!$R1 2046
6 TraesCS2B01G008800 chr3A 472399190 472400990 1800 False 1285.0 1853 91.39000 514 2564 2 chr3A.!!$F1 2050
7 TraesCS2B01G008800 chr3A 675307222 675308201 979 True 1129.0 1129 87.73900 1589 2563 1 chr3A.!!$R1 974
8 TraesCS2B01G008800 chrUn 291127426 291128409 983 False 1140.0 1140 87.86400 1589 2564 1 chrUn.!!$F1 975
9 TraesCS2B01G008800 chr4A 306974500 306975477 977 True 1116.0 1116 87.53800 1589 2563 1 chr4A.!!$R1 974
10 TraesCS2B01G008800 chr4A 159733547 159734073 526 False 527.0 527 85.28300 4 515 1 chr4A.!!$F1 511
11 TraesCS2B01G008800 chr2D 348612028 348613004 976 True 1105.0 1105 87.34900 1589 2564 1 chr2D.!!$R1 975
12 TraesCS2B01G008800 chr3B 793753694 793754206 512 True 880.0 880 97.66100 4 515 1 chr3B.!!$R1 511
13 TraesCS2B01G008800 chr4B 168957030 168957562 532 False 590.0 590 87.10300 5 523 1 chr4B.!!$F1 518
14 TraesCS2B01G008800 chr3D 68376832 68385976 9144 False 436.5 580 87.44475 4 515 4 chr3D.!!$F2 511

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
698 9364 1.601914 CGTTTGGGCCTTGTTAACTGC 60.602 52.381 4.53 6.94 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2165 10844 1.468736 GCATGAAACCTAGCAAGCAGC 60.469 52.381 0.0 0.0 46.19 5.25 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 8969 1.732259 CGCGCAAGACCTTAGTTGAAT 59.268 47.619 8.75 0.00 43.02 2.57
681 9347 6.704310 ACTGGTACAATAGGTAAATGACGTT 58.296 36.000 0.00 0.00 38.70 3.99
698 9364 1.601914 CGTTTGGGCCTTGTTAACTGC 60.602 52.381 4.53 6.94 0.00 4.40
1017 9683 1.288633 ACCATGATTCTGGATTGGGCA 59.711 47.619 0.00 0.00 39.73 5.36
1020 9686 2.601240 TGATTCTGGATTGGGCACAA 57.399 45.000 2.55 2.55 41.59 3.33
1340 10006 1.469335 AAGTTCCTTGACGCCCTCGA 61.469 55.000 0.00 0.00 39.41 4.04
1753 10419 2.988010 ACACTGTGTGAGAAGCAAGA 57.012 45.000 13.50 0.00 36.96 3.02
2373 11060 1.000731 GTGTTTATGCTTTGCAGCCCA 59.999 47.619 0.00 0.00 46.74 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 8969 7.654022 AACTTGGGTCTTAACTTGAAATTGA 57.346 32.000 0.00 0.00 0.00 2.57
618 9284 1.005867 GACGGTTTACCAGACGCCA 60.006 57.895 0.00 0.00 35.14 5.69
619 9285 2.090524 CGACGGTTTACCAGACGCC 61.091 63.158 0.00 0.00 35.14 5.68
620 9286 0.457337 ATCGACGGTTTACCAGACGC 60.457 55.000 0.00 0.00 35.14 5.19
621 9287 1.652124 CAATCGACGGTTTACCAGACG 59.348 52.381 0.00 4.88 35.14 4.18
622 9288 2.680577 ACAATCGACGGTTTACCAGAC 58.319 47.619 0.00 0.00 35.14 3.51
623 9289 3.389925 AACAATCGACGGTTTACCAGA 57.610 42.857 0.00 0.00 35.14 3.86
681 9347 1.175983 CCGCAGTTAACAAGGCCCAA 61.176 55.000 8.61 0.00 0.00 4.12
698 9364 2.911143 CTGATTCCTGGACCCCCG 59.089 66.667 0.00 0.00 34.29 5.73
1017 9683 3.799755 GGCGGCGCGAAGATTTGT 61.800 61.111 26.95 0.00 0.00 2.83
2165 10844 1.468736 GCATGAAACCTAGCAAGCAGC 60.469 52.381 0.00 0.00 46.19 5.25
2373 11060 6.909550 TTGTTAAGGGTAATGTTTGATGCT 57.090 33.333 0.00 0.00 0.00 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.