Multiple sequence alignment - TraesCS2B01G006600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G006600 chr2B 100.000 4315 0 0 1 4315 4184129 4188443 0.000000e+00 7932
1 TraesCS2B01G006600 chr2B 99.673 3667 10 2 650 4315 3905773 3909438 0.000000e+00 6704
2 TraesCS2B01G006600 chr2B 96.336 655 8 1 1 639 3904976 3905630 0.000000e+00 1062
3 TraesCS2B01G006600 chr2B 81.753 981 121 29 1061 2018 3787556 3788501 0.000000e+00 767
4 TraesCS2B01G006600 chr2B 81.628 958 118 29 1090 2024 1317985 1317063 0.000000e+00 741
5 TraesCS2B01G006600 chr2B 88.158 456 54 0 2661 3116 3789570 3790025 1.060000e-150 544
6 TraesCS2B01G006600 chr2B 87.939 456 55 0 2661 3116 1315364 1314909 4.910000e-149 538
7 TraesCS2B01G006600 chr2B 84.974 386 51 6 2213 2593 1316969 1316586 6.770000e-103 385
8 TraesCS2B01G006600 chr2B 84.833 389 52 6 2210 2593 3788598 3788984 6.770000e-103 385
9 TraesCS2B01G006600 chrUn 81.846 975 119 29 1073 2024 177132896 177131957 0.000000e+00 767
10 TraesCS2B01G006600 chrUn 81.846 975 119 29 1073 2024 306187841 306186902 0.000000e+00 767
11 TraesCS2B01G006600 chrUn 87.939 456 55 0 2661 3116 364582538 364582993 4.910000e-149 538
12 TraesCS2B01G006600 chrUn 84.974 386 51 6 2213 2593 177131863 177131480 6.770000e-103 385
13 TraesCS2B01G006600 chrUn 84.974 386 51 6 2213 2593 306186808 306186425 6.770000e-103 385
14 TraesCS2B01G006600 chr5A 82.046 919 135 23 2210 3111 599448045 599447140 0.000000e+00 756
15 TraesCS2B01G006600 chr5A 83.882 608 76 17 1063 1665 599390489 599389899 1.050000e-155 560
16 TraesCS2B01G006600 chr5A 82.496 617 84 21 1063 1665 599449045 599448439 1.780000e-143 520
17 TraesCS2B01G006600 chr5A 88.218 331 36 3 3 331 667032159 667031830 4.050000e-105 392
18 TraesCS2B01G006600 chr5A 81.915 376 62 4 2210 2585 599389519 599389150 3.240000e-81 313
19 TraesCS2B01G006600 chr5B 81.107 921 135 24 2210 3123 588777291 588776403 0.000000e+00 701
20 TraesCS2B01G006600 chr5B 79.418 996 152 35 1063 2042 588832586 588831628 0.000000e+00 654
21 TraesCS2B01G006600 chr5B 79.810 946 137 25 2192 3117 588831611 588830700 1.310000e-179 640
22 TraesCS2B01G006600 chr5B 82.018 684 73 26 1 639 591134112 591133434 1.770000e-148 536
23 TraesCS2B01G006600 chr5B 82.680 612 86 15 1063 1665 588778272 588777672 3.820000e-145 525
24 TraesCS2B01G006600 chr2D 88.844 493 42 8 1196 1686 7719168 7718687 1.030000e-165 593
25 TraesCS2B01G006600 chr2D 86.012 336 43 4 3 335 405071917 405072251 1.480000e-94 357
26 TraesCS2B01G006600 chr2D 89.352 216 18 2 874 1088 7718160 7718371 2.560000e-67 267
27 TraesCS2B01G006600 chr2D 77.812 320 47 17 333 638 306301990 306301681 4.430000e-40 176
28 TraesCS2B01G006600 chr7D 81.669 671 87 17 3 638 422726172 422726841 3.820000e-145 525
29 TraesCS2B01G006600 chr7D 87.906 339 36 5 1 335 375302470 375302133 1.120000e-105 394
30 TraesCS2B01G006600 chr7B 82.126 649 69 17 1 604 438882370 438881724 2.980000e-141 512
31 TraesCS2B01G006600 chr5D 82.161 583 71 16 1 552 384780870 384780290 1.820000e-128 470
32 TraesCS2B01G006600 chr2A 87.278 338 39 4 1 335 384989275 384989611 2.430000e-102 383
33 TraesCS2B01G006600 chr2A 88.961 308 34 0 1036 1343 5785675 5785368 8.760000e-102 381
34 TraesCS2B01G006600 chr1A 79.655 580 80 18 3 548 562070849 562071424 2.430000e-102 383
35 TraesCS2B01G006600 chr1D 87.021 339 39 5 1 335 404064327 404064664 1.130000e-100 377
36 TraesCS2B01G006600 chr1B 85.757 337 45 3 1 335 668116315 668115980 1.910000e-93 353
37 TraesCS2B01G006600 chr6A 79.747 316 41 5 331 637 461651143 461650842 1.570000e-49 207


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G006600 chr2B 4184129 4188443 4314 False 7932.000000 7932 100.000000 1 4315 1 chr2B.!!$F1 4314
1 TraesCS2B01G006600 chr2B 3904976 3909438 4462 False 3883.000000 6704 98.004500 1 4315 2 chr2B.!!$F3 4314
2 TraesCS2B01G006600 chr2B 3787556 3790025 2469 False 565.333333 767 84.914667 1061 3116 3 chr2B.!!$F2 2055
3 TraesCS2B01G006600 chr2B 1314909 1317985 3076 True 554.666667 741 84.847000 1090 3116 3 chr2B.!!$R1 2026
4 TraesCS2B01G006600 chrUn 177131480 177132896 1416 True 576.000000 767 83.410000 1073 2593 2 chrUn.!!$R1 1520
5 TraesCS2B01G006600 chrUn 306186425 306187841 1416 True 576.000000 767 83.410000 1073 2593 2 chrUn.!!$R2 1520
6 TraesCS2B01G006600 chr5A 599447140 599449045 1905 True 638.000000 756 82.271000 1063 3111 2 chr5A.!!$R3 2048
7 TraesCS2B01G006600 chr5A 599389150 599390489 1339 True 436.500000 560 82.898500 1063 2585 2 chr5A.!!$R2 1522
8 TraesCS2B01G006600 chr5B 588830700 588832586 1886 True 647.000000 654 79.614000 1063 3117 2 chr5B.!!$R3 2054
9 TraesCS2B01G006600 chr5B 588776403 588778272 1869 True 613.000000 701 81.893500 1063 3123 2 chr5B.!!$R2 2060
10 TraesCS2B01G006600 chr5B 591133434 591134112 678 True 536.000000 536 82.018000 1 639 1 chr5B.!!$R1 638
11 TraesCS2B01G006600 chr7D 422726172 422726841 669 False 525.000000 525 81.669000 3 638 1 chr7D.!!$F1 635
12 TraesCS2B01G006600 chr7B 438881724 438882370 646 True 512.000000 512 82.126000 1 604 1 chr7B.!!$R1 603
13 TraesCS2B01G006600 chr5D 384780290 384780870 580 True 470.000000 470 82.161000 1 552 1 chr5D.!!$R1 551
14 TraesCS2B01G006600 chr1A 562070849 562071424 575 False 383.000000 383 79.655000 3 548 1 chr1A.!!$F1 545

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
368 400 1.153524 AAAGCCACCCATGAGCACA 59.846 52.632 0.0 0.0 0.0 4.57 F
415 447 3.598715 CCAATCGCCGCCATGCAT 61.599 61.111 0.0 0.0 0.0 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1841 2048 1.154093 CTCGGCTTGCTGCATGTTG 60.154 57.895 15.71 9.35 45.15 3.33 R
3714 5120 9.534565 GATGTTGTAGAGAAGTATATTTCAGCA 57.465 33.333 10.26 0.00 0.00 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
368 400 1.153524 AAAGCCACCCATGAGCACA 59.846 52.632 0.00 0.00 0.00 4.57
415 447 3.598715 CCAATCGCCGCCATGCAT 61.599 61.111 0.00 0.00 0.00 3.96
1841 2048 0.450983 GCACTCAAATGCAGGAGAGC 59.549 55.000 16.87 16.15 45.39 4.09
3959 5366 0.178990 AAGGTGTCTGCCTTTGACCC 60.179 55.000 0.00 0.00 45.91 4.46
4117 5524 2.053244 TGGTAACTTTGGTCCGGGTAA 58.947 47.619 0.00 0.00 37.61 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1841 2048 1.154093 CTCGGCTTGCTGCATGTTG 60.154 57.895 15.71 9.35 45.15 3.33
3714 5120 9.534565 GATGTTGTAGAGAAGTATATTTCAGCA 57.465 33.333 10.26 0.00 0.00 4.41
3959 5366 2.978452 CTTCAGCTATGGGTCCGCCG 62.978 65.000 0.00 0.00 34.97 6.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.