Multiple sequence alignment - TraesCS2B01G006400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G006400 chr2B 100.000 2995 0 0 1 2995 4119042 4116048 0.000000e+00 5531.0
1 TraesCS2B01G006400 chr2B 99.632 2993 10 1 4 2995 3740155 3737163 0.000000e+00 5465.0
2 TraesCS2B01G006400 chr2B 99.432 2993 14 2 4 2995 3826680 3823690 0.000000e+00 5430.0
3 TraesCS2B01G006400 chr2D 87.727 1817 162 29 593 2366 7668238 7666440 0.000000e+00 2063.0
4 TraesCS2B01G006400 chr2D 89.547 794 70 8 1498 2284 7661371 7660584 0.000000e+00 994.0
5 TraesCS2B01G006400 chrUn 100.000 614 0 0 2132 2745 177171737 177172350 0.000000e+00 1134.0
6 TraesCS2B01G006400 chr4B 89.952 627 61 2 1377 2003 529356545 529355921 0.000000e+00 808.0
7 TraesCS2B01G006400 chr4B 86.441 177 22 2 1073 1248 529357026 529356851 3.050000e-45 193.0
8 TraesCS2B01G006400 chr4A 89.661 619 64 0 1377 1995 32592899 32592281 0.000000e+00 789.0
9 TraesCS2B01G006400 chr4D 88.995 627 67 2 1377 2003 430878411 430877787 0.000000e+00 774.0
10 TraesCS2B01G006400 chr5A 75.000 560 132 7 1393 1948 158653236 158652681 4.960000e-63 252.0
11 TraesCS2B01G006400 chr5D 74.690 565 125 14 1393 1948 134479187 134478632 4.990000e-58 235.0
12 TraesCS2B01G006400 chr5B 74.021 562 134 11 1393 1948 145923247 145922692 5.030000e-53 219.0
13 TraesCS2B01G006400 chr3B 100.000 29 0 0 714 742 660188169 660188141 2.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G006400 chr2B 4116048 4119042 2994 True 5531.0 5531 100.0000 1 2995 1 chr2B.!!$R3 2994
1 TraesCS2B01G006400 chr2B 3737163 3740155 2992 True 5465.0 5465 99.6320 4 2995 1 chr2B.!!$R1 2991
2 TraesCS2B01G006400 chr2B 3823690 3826680 2990 True 5430.0 5430 99.4320 4 2995 1 chr2B.!!$R2 2991
3 TraesCS2B01G006400 chr2D 7666440 7668238 1798 True 2063.0 2063 87.7270 593 2366 1 chr2D.!!$R2 1773
4 TraesCS2B01G006400 chr2D 7660584 7661371 787 True 994.0 994 89.5470 1498 2284 1 chr2D.!!$R1 786
5 TraesCS2B01G006400 chrUn 177171737 177172350 613 False 1134.0 1134 100.0000 2132 2745 1 chrUn.!!$F1 613
6 TraesCS2B01G006400 chr4B 529355921 529357026 1105 True 500.5 808 88.1965 1073 2003 2 chr4B.!!$R1 930
7 TraesCS2B01G006400 chr4A 32592281 32592899 618 True 789.0 789 89.6610 1377 1995 1 chr4A.!!$R1 618
8 TraesCS2B01G006400 chr4D 430877787 430878411 624 True 774.0 774 88.9950 1377 2003 1 chr4D.!!$R1 626
9 TraesCS2B01G006400 chr5A 158652681 158653236 555 True 252.0 252 75.0000 1393 1948 1 chr5A.!!$R1 555
10 TraesCS2B01G006400 chr5D 134478632 134479187 555 True 235.0 235 74.6900 1393 1948 1 chr5D.!!$R1 555
11 TraesCS2B01G006400 chr5B 145922692 145923247 555 True 219.0 219 74.0210 1393 1948 1 chr5B.!!$R1 555

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
859 883 5.529289 AGTCTTCTATGTTGATACAGGGGA 58.471 41.667 0.0 0.0 37.77 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2745 2993 7.227711 TCAAATTCAAACACAGACCGAATTCTA 59.772 33.333 3.52 0.0 35.75 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
859 883 5.529289 AGTCTTCTATGTTGATACAGGGGA 58.471 41.667 0.00 0.0 37.77 4.81
1154 1185 2.159787 CCTTCTTGAAGCACGACGAATG 60.160 50.000 0.00 0.0 0.00 2.67
1929 2160 0.673333 CCACGTGCTAGTCATTGCCA 60.673 55.000 10.91 0.0 0.00 4.92
2745 2993 4.221703 AGATTTGTCTCTGGTGAATCTCGT 59.778 41.667 0.00 0.0 33.11 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.887568 CATCACCGAGTCGCCAGC 60.888 66.667 7.12 0.0 0.00 4.85
1 2 2.202797 CCATCACCGAGTCGCCAG 60.203 66.667 7.12 0.0 0.00 4.85
2 3 4.451150 GCCATCACCGAGTCGCCA 62.451 66.667 7.12 0.0 0.00 5.69
1130 1161 1.302511 TCGTGCTTCAAGAAGGCCC 60.303 57.895 11.44 0.0 38.80 5.80
1154 1185 0.664767 GCGGTAGTGATCGAGGATGC 60.665 60.000 0.00 0.0 0.00 3.91
1338 1377 1.737029 CGCGAGGAAGATGAAGAAGCA 60.737 52.381 0.00 0.0 0.00 3.91
2745 2993 7.227711 TCAAATTCAAACACAGACCGAATTCTA 59.772 33.333 3.52 0.0 35.75 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.