Multiple sequence alignment - TraesCS2B01G006300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G006300 chr2B 100.000 4204 0 0 1 4204 4012566 4016769 0.000000e+00 7764.0
1 TraesCS2B01G006300 chr2B 99.287 4210 22 3 1 4204 4282065 4286272 0.000000e+00 7601.0
2 TraesCS2B01G006300 chr2B 99.308 4188 23 3 1 4183 4375460 4379646 0.000000e+00 7568.0
3 TraesCS2B01G006300 chr2B 99.258 3370 19 3 819 4183 4424119 4427487 0.000000e+00 6080.0
4 TraesCS2B01G006300 chr2B 86.752 1789 167 38 1524 3268 3796304 3794542 0.000000e+00 1927.0
5 TraesCS2B01G006300 chr2B 100.000 741 0 0 1 741 4423277 4424017 0.000000e+00 1369.0
6 TraesCS2B01G006300 chr2B 82.367 845 85 35 1524 2324 3709444 3708620 0.000000e+00 676.0
7 TraesCS2B01G006300 chr2B 81.250 112 17 4 4083 4193 719152535 719152427 2.080000e-13 87.9
8 TraesCS2B01G006300 chr2D 91.346 4033 248 39 105 4071 7832542 7836539 0.000000e+00 5421.0
9 TraesCS2B01G006300 chr2D 91.971 1096 78 5 2162 3254 7646167 7645079 0.000000e+00 1528.0
10 TraesCS2B01G006300 chr2D 90.241 748 55 5 1 733 7828994 7829738 0.000000e+00 961.0
11 TraesCS2B01G006300 chr2D 89.960 747 57 5 2 733 7830366 7831109 0.000000e+00 948.0
12 TraesCS2B01G006300 chr2D 79.792 673 101 24 1491 2131 7646935 7646266 1.380000e-124 457.0
13 TraesCS2B01G006300 chrUn 99.639 1109 4 0 164 1272 438603820 438604928 0.000000e+00 2026.0
14 TraesCS2B01G006300 chr2A 80.376 1330 227 22 1892 3199 5910913 5912230 0.000000e+00 979.0
15 TraesCS2B01G006300 chr2A 78.254 607 79 32 959 1543 5707291 5707866 1.450000e-89 340.0
16 TraesCS2B01G006300 chr4A 75.226 884 184 27 2335 3203 668442059 668441196 1.830000e-103 387.0
17 TraesCS2B01G006300 chr5B 98.077 52 1 0 299 350 601033048 601033099 1.610000e-14 91.6
18 TraesCS2B01G006300 chr6D 91.935 62 4 1 290 351 6515389 6515449 7.490000e-13 86.1
19 TraesCS2B01G006300 chr1B 85.714 70 8 2 4091 4158 1792960 1792891 5.830000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G006300 chr2B 4012566 4016769 4203 False 7764.000000 7764 100.000000 1 4204 1 chr2B.!!$F1 4203
1 TraesCS2B01G006300 chr2B 4282065 4286272 4207 False 7601.000000 7601 99.287000 1 4204 1 chr2B.!!$F2 4203
2 TraesCS2B01G006300 chr2B 4375460 4379646 4186 False 7568.000000 7568 99.308000 1 4183 1 chr2B.!!$F3 4182
3 TraesCS2B01G006300 chr2B 4423277 4427487 4210 False 3724.500000 6080 99.629000 1 4183 2 chr2B.!!$F4 4182
4 TraesCS2B01G006300 chr2B 3794542 3796304 1762 True 1927.000000 1927 86.752000 1524 3268 1 chr2B.!!$R2 1744
5 TraesCS2B01G006300 chr2B 3708620 3709444 824 True 676.000000 676 82.367000 1524 2324 1 chr2B.!!$R1 800
6 TraesCS2B01G006300 chr2D 7828994 7836539 7545 False 2443.333333 5421 90.515667 1 4071 3 chr2D.!!$F1 4070
7 TraesCS2B01G006300 chr2D 7645079 7646935 1856 True 992.500000 1528 85.881500 1491 3254 2 chr2D.!!$R1 1763
8 TraesCS2B01G006300 chrUn 438603820 438604928 1108 False 2026.000000 2026 99.639000 164 1272 1 chrUn.!!$F1 1108
9 TraesCS2B01G006300 chr2A 5910913 5912230 1317 False 979.000000 979 80.376000 1892 3199 1 chr2A.!!$F2 1307
10 TraesCS2B01G006300 chr2A 5707291 5707866 575 False 340.000000 340 78.254000 959 1543 1 chr2A.!!$F1 584
11 TraesCS2B01G006300 chr4A 668441196 668442059 863 True 387.000000 387 75.226000 2335 3203 1 chr4A.!!$R1 868

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1964 5569 1.134788 GGTTAGTGAGATCCGGTGTGG 60.135 57.143 0.00 0.0 40.09 4.17 F
2799 6495 0.390866 CACTGAGAATGCGCTCACCT 60.391 55.000 9.73 0.0 39.84 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2791 6487 1.237285 CCCCAAGTTCAAGGTGAGCG 61.237 60.0 0.00 0.0 32.57 5.03 R
3600 7296 6.274001 ACGTCAAACGATGCTTCTAATATG 57.726 37.5 6.48 0.0 46.05 1.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1964 5569 1.134788 GGTTAGTGAGATCCGGTGTGG 60.135 57.143 0.00 0.0 40.09 4.17
2791 6487 1.742880 TGCCGAGCACTGAGAATGC 60.743 57.895 0.00 0.0 43.74 3.56
2799 6495 0.390866 CACTGAGAATGCGCTCACCT 60.391 55.000 9.73 0.0 39.84 4.00
3373 7069 9.433317 CAATAATGTACGATGTTATGGTTTGTC 57.567 33.333 0.00 0.0 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
897 4381 2.289382 GCCCGGTTTGAATTTGGTCAAT 60.289 45.455 0.00 0.0 37.36 2.57
2791 6487 1.237285 CCCCAAGTTCAAGGTGAGCG 61.237 60.000 0.00 0.0 32.57 5.03
2799 6495 1.631405 CCATTGCTCCCCAAGTTCAA 58.369 50.000 0.00 0.0 36.76 2.69
3212 6908 2.540101 CTGCTGCGTACATAGCTTAACC 59.460 50.000 16.47 0.0 40.52 2.85
3373 7069 6.211587 TCATTAATGGCTGTCAAAATCAGG 57.788 37.500 15.36 0.0 33.98 3.86
3600 7296 6.274001 ACGTCAAACGATGCTTCTAATATG 57.726 37.500 6.48 0.0 46.05 1.78


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.