Multiple sequence alignment - TraesCS2B01G006200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G006200 chr2B 100.000 3229 0 0 1 3229 3906016 3909244 0.000000e+00 5963
1 TraesCS2B01G006200 chr2B 99.628 3230 10 2 1 3229 4185021 4188249 0.000000e+00 5897
2 TraesCS2B01G006200 chr2B 81.633 980 123 29 169 1125 3787556 3788501 0.000000e+00 760
3 TraesCS2B01G006200 chr2B 81.505 957 120 29 198 1131 1317985 1317063 0.000000e+00 734
4 TraesCS2B01G006200 chr2B 87.719 456 56 0 1768 2223 3789570 3790025 1.710000e-147 532
5 TraesCS2B01G006200 chr2B 87.500 456 57 0 1768 2223 1315364 1314909 7.930000e-146 527
6 TraesCS2B01G006200 chr2B 84.715 386 52 6 1320 1700 1316969 1316586 2.350000e-101 379
7 TraesCS2B01G006200 chr2B 84.576 389 53 6 1317 1700 3788598 3788984 2.350000e-101 379
8 TraesCS2B01G006200 chrUn 81.725 974 121 29 181 1131 177132896 177131957 0.000000e+00 760
9 TraesCS2B01G006200 chrUn 81.725 974 121 29 181 1131 306187841 306186902 0.000000e+00 760
10 TraesCS2B01G006200 chrUn 87.500 456 57 0 1768 2223 364582538 364582993 7.930000e-146 527
11 TraesCS2B01G006200 chrUn 84.715 386 52 6 1320 1700 177131863 177131480 2.350000e-101 379
12 TraesCS2B01G006200 chrUn 84.715 386 52 6 1320 1700 306186808 306186425 2.350000e-101 379
13 TraesCS2B01G006200 chr5A 81.719 919 138 23 1317 2218 599448045 599447140 0.000000e+00 739
14 TraesCS2B01G006200 chr5A 84.046 608 75 17 171 773 599390489 599389899 1.680000e-157 566
15 TraesCS2B01G006200 chr5A 82.658 617 83 21 171 773 599449045 599448439 2.850000e-145 525
16 TraesCS2B01G006200 chr5A 81.649 376 63 4 1317 1692 599389519 599389150 1.130000e-79 307
17 TraesCS2B01G006200 chr5B 80.999 921 136 24 1317 2230 588777291 588776403 0.000000e+00 695
18 TraesCS2B01G006200 chr5B 79.397 995 153 36 171 1149 588832586 588831628 0.000000e+00 654
19 TraesCS2B01G006200 chr5B 79.384 941 150 21 1299 2224 588831611 588830700 9.840000e-175 623
20 TraesCS2B01G006200 chr2D 89.047 493 41 8 304 794 7719168 7718687 1.660000e-167 599
21 TraesCS2B01G006200 chr2D 90.374 187 17 1 11 196 7718185 7718371 8.950000e-61 244
22 TraesCS2B01G006200 chr2A 79.263 651 97 19 491 1131 5785142 5784520 1.390000e-113 420
23 TraesCS2B01G006200 chr2A 88.961 308 34 0 144 451 5785675 5785368 6.540000e-102 381


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G006200 chr2B 3906016 3909244 3228 False 5963.000000 5963 100.000000 1 3229 1 chr2B.!!$F1 3228
1 TraesCS2B01G006200 chr2B 4185021 4188249 3228 False 5897.000000 5897 99.628000 1 3229 1 chr2B.!!$F2 3228
2 TraesCS2B01G006200 chr2B 3787556 3790025 2469 False 557.000000 760 84.642667 169 2223 3 chr2B.!!$F3 2054
3 TraesCS2B01G006200 chr2B 1314909 1317985 3076 True 546.666667 734 84.573333 198 2223 3 chr2B.!!$R1 2025
4 TraesCS2B01G006200 chrUn 177131480 177132896 1416 True 569.500000 760 83.220000 181 1700 2 chrUn.!!$R1 1519
5 TraesCS2B01G006200 chrUn 306186425 306187841 1416 True 569.500000 760 83.220000 181 1700 2 chrUn.!!$R2 1519
6 TraesCS2B01G006200 chr5A 599447140 599449045 1905 True 632.000000 739 82.188500 171 2218 2 chr5A.!!$R2 2047
7 TraesCS2B01G006200 chr5A 599389150 599390489 1339 True 436.500000 566 82.847500 171 1692 2 chr5A.!!$R1 1521
8 TraesCS2B01G006200 chr5B 588776403 588777291 888 True 695.000000 695 80.999000 1317 2230 1 chr5B.!!$R1 913
9 TraesCS2B01G006200 chr5B 588830700 588832586 1886 True 638.500000 654 79.390500 171 2224 2 chr5B.!!$R2 2053
10 TraesCS2B01G006200 chr2A 5784520 5785675 1155 True 400.500000 420 84.112000 144 1131 2 chr2A.!!$R1 987

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
986 1205 4.05674 GAGATCGACATGAGGTACGACTA 58.943 47.826 0.0 0.0 37.58 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2821 4235 7.987268 TGTTGTAGAGAAGTATATTTCAGCG 57.013 36.0 10.26 0.0 0.0 5.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
986 1205 4.056740 GAGATCGACATGAGGTACGACTA 58.943 47.826 0.0 0.0 37.58 2.59
987 1206 4.449131 AGATCGACATGAGGTACGACTAA 58.551 43.478 0.0 0.0 37.58 2.24
2902 4316 6.043127 ACTTTTGGCAGACCCTGAATATTTTT 59.957 34.615 0.0 0.0 32.44 1.94
3067 4481 0.846693 AAGGTGTCTGCCTTTGACCT 59.153 50.000 0.0 0.0 45.91 3.85
3225 4639 2.026915 GTGGTAACTTTGGTCCGGGTAT 60.027 50.000 0.0 0.0 37.61 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
855 1070 5.167845 ACTGTGAACACAAACATTCAAACC 58.832 37.500 8.93 0.00 41.33 3.27
986 1205 3.273434 ACACGCATTGCTATGTCATCTT 58.727 40.909 9.87 0.00 34.12 2.40
987 1206 2.868583 GACACGCATTGCTATGTCATCT 59.131 45.455 25.86 4.54 40.01 2.90
1488 1724 1.000993 ATCTCCTCCGTGCTCAGGT 59.999 57.895 0.00 0.00 0.00 4.00
2821 4235 7.987268 TGTTGTAGAGAAGTATATTTCAGCG 57.013 36.000 10.26 0.00 0.00 5.18
3067 4481 1.971505 CTTCAGCTATGGGTCCGCCA 61.972 60.000 0.00 0.00 36.17 5.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.