Multiple sequence alignment - TraesCS2B01G006100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G006100 chr2B 100.000 3236 0 0 1 3236 3838152 3841387 0.000000e+00 5976.0
1 TraesCS2B01G006100 chr2B 99.691 3236 6 1 1 3236 4130505 4133736 0.000000e+00 5917.0
2 TraesCS2B01G006100 chr2B 83.071 1016 168 2 999 2010 26187874 26186859 0.000000e+00 920.0
3 TraesCS2B01G006100 chr2B 87.059 85 11 0 2611 2695 430220911 430220995 2.660000e-16 97.1
4 TraesCS2B01G006100 chrUn 100.000 1997 0 0 411 2407 359562523 359564519 0.000000e+00 3688.0
5 TraesCS2B01G006100 chrUn 79.858 422 79 4 1127 1545 3511149 3510731 1.460000e-78 303.0
6 TraesCS2B01G006100 chrUn 77.848 158 32 2 277 431 94278906 94279063 9.560000e-16 95.3
7 TraesCS2B01G006100 chrUn 84.444 90 12 2 344 431 94398213 94398302 1.600000e-13 87.9
8 TraesCS2B01G006100 chrUn 83.333 90 13 2 344 431 94344241 94344330 7.440000e-12 82.4
9 TraesCS2B01G006100 chrUn 83.333 90 13 2 344 431 414706600 414706511 7.440000e-12 82.4
10 TraesCS2B01G006100 chr2D 91.262 2575 170 31 657 3196 7695609 7698163 0.000000e+00 3458.0
11 TraesCS2B01G006100 chr2D 76.390 953 189 24 1067 1986 19555816 19556765 6.280000e-132 481.0
12 TraesCS2B01G006100 chr3D 76.589 944 191 23 1067 1986 589673126 589672189 2.900000e-135 492.0
13 TraesCS2B01G006100 chr3D 76.000 225 40 8 268 480 303355837 303356059 1.590000e-18 104.0
14 TraesCS2B01G006100 chr1B 76.428 963 188 26 1067 1996 44799780 44800736 4.850000e-133 484.0
15 TraesCS2B01G006100 chr1B 84.416 154 20 4 170 321 603898907 603898756 7.230000e-32 148.0
16 TraesCS2B01G006100 chr6B 84.354 147 20 3 170 315 150911963 150911819 1.210000e-29 141.0
17 TraesCS2B01G006100 chr6B 84.884 86 13 0 346 431 43898235 43898320 1.600000e-13 87.9
18 TraesCS2B01G006100 chr6B 83.721 86 14 0 346 431 43928238 43928323 7.440000e-12 82.4
19 TraesCS2B01G006100 chr5A 84.028 144 21 2 170 312 374530919 374531061 1.570000e-28 137.0
20 TraesCS2B01G006100 chr7A 84.615 91 13 1 342 431 55143749 55143659 4.450000e-14 89.8
21 TraesCS2B01G006100 chr1D 81.308 107 20 0 166 272 441598650 441598756 1.600000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G006100 chr2B 3838152 3841387 3235 False 5976 5976 100.000 1 3236 1 chr2B.!!$F1 3235
1 TraesCS2B01G006100 chr2B 4130505 4133736 3231 False 5917 5917 99.691 1 3236 1 chr2B.!!$F2 3235
2 TraesCS2B01G006100 chr2B 26186859 26187874 1015 True 920 920 83.071 999 2010 1 chr2B.!!$R1 1011
3 TraesCS2B01G006100 chrUn 359562523 359564519 1996 False 3688 3688 100.000 411 2407 1 chrUn.!!$F4 1996
4 TraesCS2B01G006100 chr2D 7695609 7698163 2554 False 3458 3458 91.262 657 3196 1 chr2D.!!$F1 2539
5 TraesCS2B01G006100 chr2D 19555816 19556765 949 False 481 481 76.390 1067 1986 1 chr2D.!!$F2 919
6 TraesCS2B01G006100 chr3D 589672189 589673126 937 True 492 492 76.589 1067 1986 1 chr3D.!!$R1 919
7 TraesCS2B01G006100 chr1B 44799780 44800736 956 False 484 484 76.428 1067 1996 1 chr1B.!!$F1 929

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
409 410 0.804544 ACCGATACACGACCGCATTG 60.805 55.0 0.0 0.0 45.77 2.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2407 2442 1.779683 GACTTAGCCGCAACGTGAC 59.22 57.895 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 4.710324 TGGAGTAGGTTTTTCGACAATGT 58.290 39.130 0.00 0.0 0.00 2.71
194 195 4.504916 CAGGTCGCCTCCGCTCTG 62.505 72.222 0.00 0.0 0.00 3.35
409 410 0.804544 ACCGATACACGACCGCATTG 60.805 55.000 0.00 0.0 45.77 2.82
2407 2442 1.165907 TCTGCCAGAAACGTGCAAGG 61.166 55.000 4.26 0.0 34.06 3.61
2701 2751 4.184629 ACCGTGCAAGCATTTTTGTAAAA 58.815 34.783 0.00 0.0 0.00 1.52
2702 2752 4.033472 ACCGTGCAAGCATTTTTGTAAAAC 59.967 37.500 0.00 0.0 0.00 2.43
2703 2753 4.192640 CGTGCAAGCATTTTTGTAAAACG 58.807 39.130 0.00 0.0 0.00 3.60
2704 2754 4.259610 CGTGCAAGCATTTTTGTAAAACGT 60.260 37.500 0.00 0.0 0.00 3.99
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 5.004448 TCTACCGCCACATTAATGACAAAA 58.996 37.500 22.16 0.89 0.00 2.44
194 195 2.978010 CCGCATTCATACCCGGCC 60.978 66.667 0.00 0.00 33.77 6.13
340 341 2.223377 CCGCAAACCAGAGACAAACTAC 59.777 50.000 0.00 0.00 0.00 2.73
399 400 2.823593 TGCCATCCAATGCGGTCG 60.824 61.111 0.00 0.00 35.57 4.79
409 410 2.677003 CGGACGTGTTGTGCCATCC 61.677 63.158 0.00 0.00 35.07 3.51
2407 2442 1.779683 GACTTAGCCGCAACGTGAC 59.220 57.895 0.00 0.00 0.00 3.67
2701 2751 1.547223 CGGGGGATGATAGGAGTACGT 60.547 57.143 0.00 0.00 0.00 3.57
2702 2752 1.174783 CGGGGGATGATAGGAGTACG 58.825 60.000 0.00 0.00 0.00 3.67
2703 2753 1.558233 CCGGGGGATGATAGGAGTAC 58.442 60.000 0.00 0.00 0.00 2.73
2704 2754 0.412244 CCCGGGGGATGATAGGAGTA 59.588 60.000 14.71 0.00 37.50 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.