Multiple sequence alignment - TraesCS2B01G003000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G003000 chr2B 100.000 4120 0 0 1 4120 1761042 1756923 0.000000e+00 7609
1 TraesCS2B01G003000 chr2B 99.127 4122 32 3 1 4120 1776305 1772186 0.000000e+00 7409
2 TraesCS2B01G003000 chr2B 93.984 2510 128 11 1060 3567 1800554 1798066 0.000000e+00 3777
3 TraesCS2B01G003000 chr2B 89.824 511 24 11 3636 4120 1797895 1797387 7.520000e-177 630
4 TraesCS2B01G003000 chr2B 92.361 432 16 3 594 1015 1800991 1800567 2.120000e-167 599
5 TraesCS2B01G003000 chr2B 89.963 269 22 3 973 1237 237584489 237584756 3.940000e-90 342
6 TraesCS2B01G003000 chr2D 87.220 1025 114 8 1234 2254 7176866 7177877 0.000000e+00 1151
7 TraesCS2B01G003000 chr2D 82.205 916 144 15 1380 2287 23180164 23179260 0.000000e+00 771
8 TraesCS2B01G003000 chr2D 86.099 669 85 5 2630 3292 7197101 7197767 0.000000e+00 713
9 TraesCS2B01G003000 chr2D 83.712 264 32 11 3854 4116 571925053 571924800 5.320000e-59 239
10 TraesCS2B01G003000 chr2D 83.128 243 33 7 3854 4092 629969921 629970159 8.970000e-52 215
11 TraesCS2B01G003000 chr2A 90.637 267 20 3 975 1237 575349284 575349019 2.360000e-92 350
12 TraesCS2B01G003000 chr4A 90.602 266 20 3 976 1237 597820071 597820335 8.480000e-92 348
13 TraesCS2B01G003000 chr3B 91.154 260 18 3 972 1227 17707711 17707969 8.480000e-92 348
14 TraesCS2B01G003000 chr3B 91.406 256 17 3 974 1225 772172468 772172722 3.050000e-91 346
15 TraesCS2B01G003000 chr3B 91.085 258 18 3 974 1227 772260739 772260995 1.100000e-90 344
16 TraesCS2B01G003000 chr5D 89.591 269 22 3 976 1240 249158463 249158729 1.830000e-88 337
17 TraesCS2B01G003000 chr5D 87.701 187 20 3 3855 4038 413063322 413063508 8.970000e-52 215
18 TraesCS2B01G003000 chr7A 84.848 264 27 11 3853 4114 432966045 432966297 1.900000e-63 254
19 TraesCS2B01G003000 chr1B 85.892 241 28 6 3854 4092 525829999 525829763 6.840000e-63 252
20 TraesCS2B01G003000 chr1D 83.712 264 32 11 3854 4116 83695421 83695168 5.320000e-59 239
21 TraesCS2B01G003000 chr3A 88.770 187 20 1 3854 4039 155959848 155960034 1.150000e-55 228
22 TraesCS2B01G003000 chr4D 76.256 219 50 2 2673 2890 503565316 503565533 9.360000e-22 115


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G003000 chr2B 1756923 1761042 4119 True 7609.000000 7609 100.000000 1 4120 1 chr2B.!!$R1 4119
1 TraesCS2B01G003000 chr2B 1772186 1776305 4119 True 7409.000000 7409 99.127000 1 4120 1 chr2B.!!$R2 4119
2 TraesCS2B01G003000 chr2B 1797387 1800991 3604 True 1668.666667 3777 92.056333 594 4120 3 chr2B.!!$R3 3526
3 TraesCS2B01G003000 chr2D 7176866 7177877 1011 False 1151.000000 1151 87.220000 1234 2254 1 chr2D.!!$F1 1020
4 TraesCS2B01G003000 chr2D 23179260 23180164 904 True 771.000000 771 82.205000 1380 2287 1 chr2D.!!$R1 907
5 TraesCS2B01G003000 chr2D 7197101 7197767 666 False 713.000000 713 86.099000 2630 3292 1 chr2D.!!$F2 662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
630 631 0.842030 TCCCTGTGACTGGGATGCTT 60.842 55.0 24.33 0.0 44.81 3.91 F
2270 2298 0.238289 CACACACACGATCAAAGCCC 59.762 55.0 0.00 0.0 0.00 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2457 2486 1.619654 CACCTTTTGCATCACCCTCA 58.380 50.000 0.0 0.0 0.00 3.86 R
3757 3891 7.068593 TGCCTCATTCTTCTTATAATGGTTTGG 59.931 37.037 0.0 0.0 34.52 3.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 125 1.507140 TGAACTTGTGAGACCCCACT 58.493 50.000 0.00 0.00 37.89 4.00
214 215 5.422214 TTTGGGGTAAAACAACACACAAT 57.578 34.783 0.00 0.00 0.00 2.71
225 226 5.499139 ACAACACACAATACCTCAGTTTG 57.501 39.130 0.00 0.00 0.00 2.93
245 246 4.986054 TGAAGCCTTGGGAAAGTACTTA 57.014 40.909 8.92 0.00 0.00 2.24
414 415 7.832503 ATACTTTAACTGCATTTTGGATTGC 57.167 32.000 0.00 0.00 39.33 3.56
542 543 9.268282 TCTTAATTACTCCCTCTGTAAACTGAT 57.732 33.333 0.00 0.00 34.20 2.90
630 631 0.842030 TCCCTGTGACTGGGATGCTT 60.842 55.000 24.33 0.00 44.81 3.91
982 993 3.741344 GCAGCTATACAAATGTACTCCCG 59.259 47.826 0.00 0.00 32.72 5.14
1229 1241 7.765360 TGAAAGTACACTCTTTTAAGGACGAAA 59.235 33.333 0.00 0.00 37.70 3.46
1435 1463 3.452264 CACTTGGAGTACTCATCATCCCA 59.548 47.826 23.91 9.06 0.00 4.37
2270 2298 0.238289 CACACACACGATCAAAGCCC 59.762 55.000 0.00 0.00 0.00 5.19
2457 2486 1.205893 GTCCGAGCTCATGAAGAACCT 59.794 52.381 15.40 0.00 0.00 3.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 1.022735 CATCCATGACAGCCTTGAGC 58.977 55.000 0.00 0.00 44.25 4.26
214 215 2.224769 CCCAAGGCTTCAAACTGAGGTA 60.225 50.000 0.00 0.00 0.00 3.08
225 226 4.648651 TGTAAGTACTTTCCCAAGGCTTC 58.351 43.478 14.49 0.00 33.82 3.86
245 246 4.689612 ATGGCGAAGTATTGGTAGATGT 57.310 40.909 0.00 0.00 0.00 3.06
414 415 9.941664 ATTTTCGCTCTCAATGACAAATATAAG 57.058 29.630 0.00 0.00 0.00 1.73
630 631 5.777802 TGTTTCTTCAGTTCAAACAAGCAA 58.222 33.333 0.00 0.00 37.14 3.91
836 847 9.796120 TTGAAAGTTGTTAAGTCTAATTGTTGG 57.204 29.630 0.00 0.00 0.00 3.77
982 993 5.642491 AGAAATACACTCTTTTAAGGACGGC 59.358 40.000 0.00 0.00 0.00 5.68
1058 1069 8.320617 ACTAATTTGATGGCATAAATGTTGGTT 58.679 29.630 0.00 0.00 0.00 3.67
1229 1241 6.715280 CCATTGGCCATCATATACTACTCTT 58.285 40.000 6.09 0.00 0.00 2.85
1289 1301 1.333619 CAAGTGCCGGCCATTACATAC 59.666 52.381 26.77 12.96 0.00 2.39
1435 1463 2.659428 GCAAGGATGAAGTAGGCCAAT 58.341 47.619 5.01 0.00 0.00 3.16
1586 1614 1.662608 CGAGGCGGAGTAGCATCAT 59.337 57.895 4.58 0.00 46.90 2.45
1901 1929 2.233922 ACAGTAGTGCGCTAAGGTTCAT 59.766 45.455 8.93 0.00 0.00 2.57
2270 2298 2.604046 AACTAGCTTACCGCCATCAG 57.396 50.000 0.00 0.00 40.39 2.90
2457 2486 1.619654 CACCTTTTGCATCACCCTCA 58.380 50.000 0.00 0.00 0.00 3.86
3757 3891 7.068593 TGCCTCATTCTTCTTATAATGGTTTGG 59.931 37.037 0.00 0.00 34.52 3.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.