Multiple sequence alignment - TraesCS2B01G001300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G001300 chr2B 100.000 1477 0 0 818 2294 811341 809865 0.000000e+00 2728
1 TraesCS2B01G001300 chr2B 100.000 544 0 0 1 544 812158 811615 0.000000e+00 1005
2 TraesCS2B01G001300 chr2B 94.286 70 4 0 818 887 220433521 220433590 8.670000e-20 108
3 TraesCS2B01G001300 chr1B 97.358 1476 36 3 818 2292 235897818 235899291 0.000000e+00 2507
4 TraesCS2B01G001300 chr1B 97.165 1164 31 2 818 1980 658504112 658502950 0.000000e+00 1965
5 TraesCS2B01G001300 chr1B 97.426 544 12 1 1 544 658505124 658504583 0.000000e+00 926
6 TraesCS2B01G001300 chr1B 97.243 544 14 1 1 544 235896706 235897248 0.000000e+00 920
7 TraesCS2B01G001300 chr1B 99.375 320 2 0 1975 2294 658502597 658502278 4.250000e-162 580
8 TraesCS2B01G001300 chr7A 95.708 1165 48 2 818 1980 707844410 707845574 0.000000e+00 1873
9 TraesCS2B01G001300 chr7A 95.279 1165 53 2 818 1980 650324540 650323376 0.000000e+00 1845
10 TraesCS2B01G001300 chr7A 95.275 1164 53 2 818 1980 650260724 650259562 0.000000e+00 1844
11 TraesCS2B01G001300 chr7A 98.750 320 4 0 1975 2294 512542103 512542422 9.200000e-159 569
12 TraesCS2B01G001300 chr7A 85.772 492 41 18 886 1363 689905250 689905726 5.690000e-136 494
13 TraesCS2B01G001300 chr2A 95.521 1161 51 1 821 1980 23796207 23797367 0.000000e+00 1855
14 TraesCS2B01G001300 chr2A 95.107 1165 54 3 818 1980 600113414 600112251 0.000000e+00 1832
15 TraesCS2B01G001300 chr2A 98.438 320 4 1 1975 2294 23797719 23798037 1.540000e-156 562
16 TraesCS2B01G001300 chr2A 98.125 320 5 1 1975 2294 107527695 107528013 7.160000e-155 556
17 TraesCS2B01G001300 chr1A 95.021 1165 56 2 818 1980 380400832 380401996 0.000000e+00 1829
18 TraesCS2B01G001300 chr1A 94.845 1164 58 2 818 1980 531840031 531838869 0.000000e+00 1816
19 TraesCS2B01G001300 chr1A 97.812 320 7 0 1975 2294 11024792 11024473 9.260000e-154 553
20 TraesCS2B01G001300 chr1A 97.812 320 7 0 1975 2294 31699452 31699771 9.260000e-154 553
21 TraesCS2B01G001300 chr3B 98.162 544 10 0 1 544 59099223 59099766 0.000000e+00 950
22 TraesCS2B01G001300 chr3B 99.688 321 0 1 1975 2294 59101569 59101889 9.130000e-164 586
23 TraesCS2B01G001300 chrUn 94.485 544 30 0 1 544 24704440 24704983 0.000000e+00 839
24 TraesCS2B01G001300 chr4D 93.911 542 32 1 1 542 4184678 4185218 0.000000e+00 817
25 TraesCS2B01G001300 chr7B 93.382 544 34 2 1 544 656625598 656625057 0.000000e+00 804
26 TraesCS2B01G001300 chr5D 92.764 539 37 2 5 542 239142 238605 0.000000e+00 778
27 TraesCS2B01G001300 chr1D 92.308 546 38 4 1 544 65739837 65740380 0.000000e+00 773
28 TraesCS2B01G001300 chr7D 92.125 546 39 4 1 544 173526150 173526693 0.000000e+00 767
29 TraesCS2B01G001300 chr6B 98.119 319 6 0 1975 2293 363205111 363205429 7.160000e-155 556


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G001300 chr2B 809865 812158 2293 True 1866.5 2728 100.000000 1 2294 2 chr2B.!!$R1 2293
1 TraesCS2B01G001300 chr1B 235896706 235899291 2585 False 1713.5 2507 97.300500 1 2292 2 chr1B.!!$F1 2291
2 TraesCS2B01G001300 chr1B 658502278 658505124 2846 True 1157.0 1965 97.988667 1 2294 3 chr1B.!!$R1 2293
3 TraesCS2B01G001300 chr7A 707844410 707845574 1164 False 1873.0 1873 95.708000 818 1980 1 chr7A.!!$F3 1162
4 TraesCS2B01G001300 chr7A 650323376 650324540 1164 True 1845.0 1845 95.279000 818 1980 1 chr7A.!!$R2 1162
5 TraesCS2B01G001300 chr7A 650259562 650260724 1162 True 1844.0 1844 95.275000 818 1980 1 chr7A.!!$R1 1162
6 TraesCS2B01G001300 chr2A 600112251 600113414 1163 True 1832.0 1832 95.107000 818 1980 1 chr2A.!!$R1 1162
7 TraesCS2B01G001300 chr2A 23796207 23798037 1830 False 1208.5 1855 96.979500 821 2294 2 chr2A.!!$F2 1473
8 TraesCS2B01G001300 chr1A 380400832 380401996 1164 False 1829.0 1829 95.021000 818 1980 1 chr1A.!!$F2 1162
9 TraesCS2B01G001300 chr1A 531838869 531840031 1162 True 1816.0 1816 94.845000 818 1980 1 chr1A.!!$R2 1162
10 TraesCS2B01G001300 chr3B 59099223 59101889 2666 False 768.0 950 98.925000 1 2294 2 chr3B.!!$F1 2293
11 TraesCS2B01G001300 chrUn 24704440 24704983 543 False 839.0 839 94.485000 1 544 1 chrUn.!!$F1 543
12 TraesCS2B01G001300 chr4D 4184678 4185218 540 False 817.0 817 93.911000 1 542 1 chr4D.!!$F1 541
13 TraesCS2B01G001300 chr7B 656625057 656625598 541 True 804.0 804 93.382000 1 544 1 chr7B.!!$R1 543
14 TraesCS2B01G001300 chr5D 238605 239142 537 True 778.0 778 92.764000 5 542 1 chr5D.!!$R1 537
15 TraesCS2B01G001300 chr1D 65739837 65740380 543 False 773.0 773 92.308000 1 544 1 chr1D.!!$F1 543
16 TraesCS2B01G001300 chr7D 173526150 173526693 543 False 767.0 767 92.125000 1 544 1 chr7D.!!$F1 543

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
507 510 1.07597 CTCTCCCCGACCCATGAGA 60.076 63.158 0.0 0.0 33.14 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1537 2180 3.130869 AGCGGCAATGATTTAAGCATGAA 59.869 39.13 1.45 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
210 211 5.971202 GGAAATGCATACAAGTTGGTTATCG 59.029 40.000 7.96 0.00 0.00 2.92
215 216 4.393680 GCATACAAGTTGGTTATCGTCCAA 59.606 41.667 7.96 0.00 41.84 3.53
505 508 2.041922 CCTCTCCCCGACCCATGA 60.042 66.667 0.00 0.00 0.00 3.07
507 510 1.075970 CTCTCCCCGACCCATGAGA 60.076 63.158 0.00 0.00 33.14 3.27
872 1171 4.095400 GCCTCCTCCTCCCCTCCA 62.095 72.222 0.00 0.00 0.00 3.86
1174 1815 1.737735 CTGACGCTGATTCGGCACA 60.738 57.895 17.31 14.21 43.38 4.57
1279 1920 3.735720 TCCCCATCAACAACATCATCA 57.264 42.857 0.00 0.00 0.00 3.07
1372 2013 3.112709 GTCCTGTTGTCTCGCGCC 61.113 66.667 0.00 0.00 0.00 6.53
1520 2163 2.361119 TCGGATGAGTCAAGGGTAATCG 59.639 50.000 0.00 0.00 0.00 3.34
1537 2180 3.580319 GGCTGTGGGGAACTGGGT 61.580 66.667 0.00 0.00 0.00 4.51
1548 2191 3.161866 GGGAACTGGGTTCATGCTTAAA 58.838 45.455 11.67 0.00 43.54 1.52
1720 2363 5.700402 AAATTGGCACCTACTGAGTAGAT 57.300 39.130 20.66 0.00 38.29 1.98
1860 2504 2.985957 ACACACATGGCAAGCTTTTT 57.014 40.000 0.00 0.00 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
247 248 2.629336 TTTCCAAAAATGGCACCACC 57.371 45.000 0.00 0.0 39.84 4.61
872 1171 1.317613 TTTGTGCTTTGGATCTGCGT 58.682 45.000 0.00 0.0 0.00 5.24
1050 1691 1.506718 CTTGACGAGGCAGACGCTA 59.493 57.895 0.00 0.0 38.60 4.26
1174 1815 0.179018 GCCACCTTGGTGAACTCTGT 60.179 55.000 20.27 0.0 40.46 3.41
1520 2163 3.146828 AACCCAGTTCCCCACAGCC 62.147 63.158 0.00 0.0 0.00 4.85
1537 2180 3.130869 AGCGGCAATGATTTAAGCATGAA 59.869 39.130 1.45 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.