Multiple sequence alignment - TraesCS2B01G000400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G000400 chr2B 100.000 3551 0 0 1 3551 62933 66483 0.000000e+00 6558.0
1 TraesCS2B01G000400 chr2B 99.043 3551 23 3 1 3551 177190 180729 0.000000e+00 6359.0
2 TraesCS2B01G000400 chr2B 94.756 1964 78 5 764 2726 476985 478924 0.000000e+00 3033.0
3 TraesCS2B01G000400 chr2B 91.994 687 50 5 2759 3442 478927 479611 0.000000e+00 959.0
4 TraesCS2B01G000400 chr2B 82.793 1017 134 16 1796 2798 9198300 9197311 0.000000e+00 870.0
5 TraesCS2B01G000400 chr2B 80.000 975 178 15 1798 2755 9105682 9104708 0.000000e+00 704.0
6 TraesCS2B01G000400 chr2B 90.625 320 15 6 372 691 476671 476975 9.170000e-111 411.0
7 TraesCS2B01G000400 chr2A 90.253 1939 143 15 1227 3153 1915777 1917681 0.000000e+00 2492.0
8 TraesCS2B01G000400 chr2A 83.276 1154 157 25 1796 2929 2876956 2878093 0.000000e+00 1029.0
9 TraesCS2B01G000400 chr2A 87.557 876 96 5 898 1773 1883749 1884611 0.000000e+00 1002.0
10 TraesCS2B01G000400 chr2A 91.096 730 54 6 1826 2551 1884700 1885422 0.000000e+00 977.0
11 TraesCS2B01G000400 chr2A 79.974 759 142 7 1023 1773 2405968 2406724 5.180000e-153 551.0
12 TraesCS2B01G000400 chr2A 80.027 736 138 8 1040 1771 2876249 2876979 1.450000e-148 536.0
13 TraesCS2B01G000400 chr2A 87.903 372 36 8 3153 3518 1918137 1918505 2.530000e-116 429.0
14 TraesCS2B01G000400 chr2A 81.356 295 28 9 379 665 1908168 1908443 7.720000e-52 215.0
15 TraesCS2B01G000400 chr2A 82.731 249 15 13 678 912 1882749 1882983 2.800000e-46 196.0
16 TraesCS2B01G000400 chr2A 91.304 46 2 2 66 109 94121950 94121905 1.060000e-05 62.1
17 TraesCS2B01G000400 chr2A 97.222 36 0 1 3016 3051 200889434 200889468 3.830000e-05 60.2
18 TraesCS2B01G000400 chr2D 93.959 1225 50 1 1385 2609 2014475 2015675 0.000000e+00 1831.0
19 TraesCS2B01G000400 chr2D 95.694 627 23 4 678 1300 2013859 2014485 0.000000e+00 1005.0
20 TraesCS2B01G000400 chr2D 86.898 664 87 0 1895 2558 2511400 2510737 0.000000e+00 745.0
21 TraesCS2B01G000400 chr2D 87.550 249 22 8 419 665 2013122 2013363 2.700000e-71 279.0
22 TraesCS2B01G000400 chr2D 91.200 125 11 0 678 802 2165325 2165449 1.700000e-38 171.0
23 TraesCS2B01G000400 chr2D 91.489 47 2 1 65 109 95643123 95643077 2.960000e-06 63.9
24 TraesCS2B01G000400 chrUn 80.784 765 135 9 1018 1773 15864958 15865719 3.950000e-164 588.0
25 TraesCS2B01G000400 chrUn 80.084 713 138 3 1063 1773 15760377 15759667 8.730000e-146 527.0
26 TraesCS2B01G000400 chrUn 91.304 46 2 2 66 109 32987279 32987234 1.060000e-05 62.1
27 TraesCS2B01G000400 chr7D 79.739 765 143 10 1017 1772 14422342 14421581 8.670000e-151 544.0
28 TraesCS2B01G000400 chr1A 95.455 44 0 1 67 108 547586578 547586535 6.360000e-08 69.4
29 TraesCS2B01G000400 chr6D 95.238 42 0 1 70 109 328977412 328977371 8.230000e-07 65.8
30 TraesCS2B01G000400 chr4D 93.182 44 1 1 68 109 428381140 428381097 2.960000e-06 63.9
31 TraesCS2B01G000400 chr6B 100.000 32 0 0 3016 3047 345463785 345463754 3.830000e-05 60.2
32 TraesCS2B01G000400 chr6B 100.000 29 0 0 70 98 493323204 493323176 2.000000e-03 54.7
33 TraesCS2B01G000400 chr6A 100.000 32 0 0 3016 3047 340035663 340035632 3.830000e-05 60.2
34 TraesCS2B01G000400 chr5D 94.737 38 2 0 3016 3053 406213254 406213217 3.830000e-05 60.2
35 TraesCS2B01G000400 chr5B 94.737 38 2 0 3016 3053 486911228 486911191 3.830000e-05 60.2
36 TraesCS2B01G000400 chr5A 97.059 34 1 0 66 99 588378010 588377977 1.380000e-04 58.4
37 TraesCS2B01G000400 chr3D 92.105 38 3 0 3016 3053 596055425 596055388 2.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G000400 chr2B 62933 66483 3550 False 6558.000000 6558 100.000000 1 3551 1 chr2B.!!$F1 3550
1 TraesCS2B01G000400 chr2B 177190 180729 3539 False 6359.000000 6359 99.043000 1 3551 1 chr2B.!!$F2 3550
2 TraesCS2B01G000400 chr2B 476671 479611 2940 False 1467.666667 3033 92.458333 372 3442 3 chr2B.!!$F3 3070
3 TraesCS2B01G000400 chr2B 9197311 9198300 989 True 870.000000 870 82.793000 1796 2798 1 chr2B.!!$R2 1002
4 TraesCS2B01G000400 chr2B 9104708 9105682 974 True 704.000000 704 80.000000 1798 2755 1 chr2B.!!$R1 957
5 TraesCS2B01G000400 chr2A 1915777 1918505 2728 False 1460.500000 2492 89.078000 1227 3518 2 chr2A.!!$F5 2291
6 TraesCS2B01G000400 chr2A 2876249 2878093 1844 False 782.500000 1029 81.651500 1040 2929 2 chr2A.!!$F6 1889
7 TraesCS2B01G000400 chr2A 1882749 1885422 2673 False 725.000000 1002 87.128000 678 2551 3 chr2A.!!$F4 1873
8 TraesCS2B01G000400 chr2A 2405968 2406724 756 False 551.000000 551 79.974000 1023 1773 1 chr2A.!!$F2 750
9 TraesCS2B01G000400 chr2D 2013122 2015675 2553 False 1038.333333 1831 92.401000 419 2609 3 chr2D.!!$F2 2190
10 TraesCS2B01G000400 chr2D 2510737 2511400 663 True 745.000000 745 86.898000 1895 2558 1 chr2D.!!$R1 663
11 TraesCS2B01G000400 chrUn 15864958 15865719 761 False 588.000000 588 80.784000 1018 1773 1 chrUn.!!$F1 755
12 TraesCS2B01G000400 chrUn 15759667 15760377 710 True 527.000000 527 80.084000 1063 1773 1 chrUn.!!$R1 710
13 TraesCS2B01G000400 chr7D 14421581 14422342 761 True 544.000000 544 79.739000 1017 1772 1 chr7D.!!$R1 755

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1952 3338 0.037975 GCTGCAAGGGACACAATTGG 60.038 55.0 10.83 1.35 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3183 5057 0.635731 TTGCGCGAAAACAAACAACG 59.364 45.0 12.1 0.0 0.0 4.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1951 3337 3.502237 GCTGCAAGGGACACAATTG 57.498 52.632 3.24 3.24 0.00 2.32
1952 3338 0.037975 GCTGCAAGGGACACAATTGG 60.038 55.000 10.83 1.35 0.00 3.16
2518 3913 6.969043 TGTATACTGGAGATGAAAAATGGGT 58.031 36.000 4.17 0.00 0.00 4.51
2581 3982 5.733620 TCTGGTCTTATGTAAACGTCCTT 57.266 39.130 0.00 0.00 0.00 3.36
2582 3983 6.839124 TCTGGTCTTATGTAAACGTCCTTA 57.161 37.500 0.00 0.00 0.00 2.69
2757 4167 5.817296 CGAGACATGATGTTTTCCTCCATTA 59.183 40.000 0.00 0.00 0.00 1.90
2866 4277 2.666508 GCAAGAGATGTGCTGCATTTTG 59.333 45.455 5.27 2.74 38.06 2.44
3185 5059 9.738832 AAACATTTTTGTTGTTATAGCTTACGT 57.261 25.926 0.00 0.00 36.32 3.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1947 3333 2.899256 CCATGTCAGGGTTGTTCCAATT 59.101 45.455 0.00 0.0 38.11 2.32
1948 3334 2.109834 TCCATGTCAGGGTTGTTCCAAT 59.890 45.455 2.95 0.0 38.11 3.16
1949 3335 1.496857 TCCATGTCAGGGTTGTTCCAA 59.503 47.619 2.95 0.0 38.11 3.53
1950 3336 1.144691 TCCATGTCAGGGTTGTTCCA 58.855 50.000 2.95 0.0 38.11 3.53
1951 3337 2.514458 ATCCATGTCAGGGTTGTTCC 57.486 50.000 2.95 0.0 0.00 3.62
1952 3338 4.871933 AAAATCCATGTCAGGGTTGTTC 57.128 40.909 2.95 0.0 30.79 3.18
2023 3415 1.338107 CATGATGCAATGGGCCAGAT 58.662 50.000 13.78 0.0 43.89 2.90
2757 4167 9.551734 TGTACTAACACATACGTAGTCTCATAT 57.448 33.333 0.08 0.0 43.93 1.78
2862 4273 2.691409 CTATCGGAGCAGTCCCAAAA 57.309 50.000 0.00 0.0 40.20 2.44
2932 4344 1.558294 GGGTTGTGTTCTAGTAGGGGG 59.442 57.143 0.00 0.0 0.00 5.40
3183 5057 0.635731 TTGCGCGAAAACAAACAACG 59.364 45.000 12.10 0.0 0.00 4.10
3185 5059 1.656095 CCTTTGCGCGAAAACAAACAA 59.344 42.857 12.10 0.0 32.60 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.