Multiple sequence alignment - TraesCS2A01G579800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G579800 chr2A 100.000 2600 0 0 1 2600 772280121 772277522 0 4802
1 TraesCS2A01G579800 chr2A 97.169 2614 52 10 1 2599 32424757 32427363 0 4397
2 TraesCS2A01G579800 chr2A 97.131 2614 58 6 1 2599 669664306 669666917 0 4396
3 TraesCS2A01G579800 chr2A 97.400 2538 47 8 77 2599 765310764 765308231 0 4303
4 TraesCS2A01G579800 chr7A 97.055 2615 59 7 1 2599 724212826 724215438 0 4386
5 TraesCS2A01G579800 chr7A 97.190 2598 51 10 1 2583 2033205 2035795 0 4373
6 TraesCS2A01G579800 chr4A 97.193 2601 51 8 1 2583 635798376 635795780 0 4379
7 TraesCS2A01G579800 chr4A 97.190 2598 49 8 1 2583 17867227 17864639 0 4372
8 TraesCS2A01G579800 chr6B 96.013 2558 67 8 57 2599 37739633 37737096 0 4126
9 TraesCS2A01G579800 chr1A 96.985 2421 52 9 180 2583 12280959 12278543 0 4047
10 TraesCS2A01G579800 chr5A 96.070 2214 70 6 401 2599 647459322 647461533 0 3591
11 TraesCS2A01G579800 chrUn 95.346 2213 87 5 401 2599 48348597 48346387 0 3502
12 TraesCS2A01G579800 chr7D 95.264 2217 86 10 401 2599 622015806 622013591 0 3494
13 TraesCS2A01G579800 chr6A 97.308 1449 26 2 1163 2598 575511569 575510121 0 2447


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G579800 chr2A 772277522 772280121 2599 True 4802 4802 100.000 1 2600 1 chr2A.!!$R2 2599
1 TraesCS2A01G579800 chr2A 32424757 32427363 2606 False 4397 4397 97.169 1 2599 1 chr2A.!!$F1 2598
2 TraesCS2A01G579800 chr2A 669664306 669666917 2611 False 4396 4396 97.131 1 2599 1 chr2A.!!$F2 2598
3 TraesCS2A01G579800 chr2A 765308231 765310764 2533 True 4303 4303 97.400 77 2599 1 chr2A.!!$R1 2522
4 TraesCS2A01G579800 chr7A 724212826 724215438 2612 False 4386 4386 97.055 1 2599 1 chr7A.!!$F2 2598
5 TraesCS2A01G579800 chr7A 2033205 2035795 2590 False 4373 4373 97.190 1 2583 1 chr7A.!!$F1 2582
6 TraesCS2A01G579800 chr4A 635795780 635798376 2596 True 4379 4379 97.193 1 2583 1 chr4A.!!$R2 2582
7 TraesCS2A01G579800 chr4A 17864639 17867227 2588 True 4372 4372 97.190 1 2583 1 chr4A.!!$R1 2582
8 TraesCS2A01G579800 chr6B 37737096 37739633 2537 True 4126 4126 96.013 57 2599 1 chr6B.!!$R1 2542
9 TraesCS2A01G579800 chr1A 12278543 12280959 2416 True 4047 4047 96.985 180 2583 1 chr1A.!!$R1 2403
10 TraesCS2A01G579800 chr5A 647459322 647461533 2211 False 3591 3591 96.070 401 2599 1 chr5A.!!$F1 2198
11 TraesCS2A01G579800 chrUn 48346387 48348597 2210 True 3502 3502 95.346 401 2599 1 chrUn.!!$R1 2198
12 TraesCS2A01G579800 chr7D 622013591 622015806 2215 True 3494 3494 95.264 401 2599 1 chr7D.!!$R1 2198
13 TraesCS2A01G579800 chr6A 575510121 575511569 1448 True 2447 2447 97.308 1163 2598 1 chr6A.!!$R1 1435

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
462 473 3.62306 GCTTGTGTGATATGTGGTTCGAT 59.377 43.478 0.0 0.0 0.0 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2193 2228 3.467226 CCACGCAGACCCGGGTAT 61.467 66.667 30.38 23.79 0.0 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
170 172 8.132362 TCACATTGTCCAATTAACACTTTGTAC 58.868 33.333 0.00 0.0 0.00 2.90
178 182 9.959749 TCCAATTAACACTTTGTACAGATTTTC 57.040 29.630 0.00 0.0 0.00 2.29
462 473 3.623060 GCTTGTGTGATATGTGGTTCGAT 59.377 43.478 0.00 0.0 0.00 3.59
604 619 4.412843 TCCCATTCTACCGCATATCTACA 58.587 43.478 0.00 0.0 0.00 2.74
844 860 4.038763 AGTTCTGGTGTGATTCGAGTACAA 59.961 41.667 0.00 0.0 0.00 2.41
876 892 6.384224 TGCAAGAGCTTTTTGATTGATAGTG 58.616 36.000 14.08 0.0 42.74 2.74
1225 1242 8.660295 TGAAGAAAAGTATAAGAGGGACTGTA 57.340 34.615 0.00 0.0 41.55 2.74
1632 1661 0.671781 GCACAGTCGCCATTCACTCT 60.672 55.000 0.00 0.0 0.00 3.24
1691 1720 2.647299 AGTCCACCCCAACAACATATCA 59.353 45.455 0.00 0.0 0.00 2.15
1764 1794 6.829298 TGGTATGACCTTTCAAAACTTGTGTA 59.171 34.615 0.00 0.0 39.58 2.90
1773 1803 8.147704 CCTTTCAAAACTTGTGTATAAACCCAT 58.852 33.333 0.00 0.0 0.00 4.00
2193 2228 4.408276 AGGAGCAGAACTGTACTACTTCA 58.592 43.478 3.77 0.0 0.00 3.02
2247 2282 2.942804 TGTTCTTGATTGCAGGACCAA 58.057 42.857 0.00 0.0 28.91 3.67
2599 2634 0.865111 CAATCTCCAACGACGCAACA 59.135 50.000 0.00 0.0 0.00 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
393 404 1.079127 CGCCACCCACCACTCTAAG 60.079 63.158 0.00 0.00 0.00 2.18
462 473 4.002506 ATGTGCACTGACCGCGGA 62.003 61.111 35.90 9.83 0.00 5.54
604 619 2.252945 AGATGGGGGTGGTTAGGATAGT 59.747 50.000 0.00 0.00 0.00 2.12
844 860 4.521639 TCAAAAAGCTCTTGCATGACATCT 59.478 37.500 0.00 0.00 42.74 2.90
876 892 5.731723 CAGTTCGTACGATCAACTAGTACAC 59.268 44.000 24.07 13.11 40.32 2.90
923 939 8.554835 TCATCCAACTAATTCGAAACAATACA 57.445 30.769 0.00 0.00 0.00 2.29
989 1005 3.708631 CTCTGAGACCATGGTCCTTACAT 59.291 47.826 36.09 20.15 45.59 2.29
994 1010 0.980231 GCCTCTGAGACCATGGTCCT 60.980 60.000 36.09 24.80 45.59 3.85
1691 1720 5.731678 AGGTACTTACAAGGGGAGAATTGAT 59.268 40.000 0.00 0.00 27.25 2.57
1764 1794 8.339714 CGTATGAAACGTTGATAATGGGTTTAT 58.660 33.333 0.00 0.00 46.72 1.40
1791 1821 4.263905 TGCCATCACAGGTTTCTTATCCTT 60.264 41.667 0.00 0.00 30.91 3.36
2171 2206 4.408276 TGAAGTAGTACAGTTCTGCTCCT 58.592 43.478 2.52 0.00 37.46 3.69
2193 2228 3.467226 CCACGCAGACCCGGGTAT 61.467 66.667 30.38 23.79 0.00 2.73
2476 2511 4.021016 GGTCTTTCTCTGCCAACTCTCTAA 60.021 45.833 0.00 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.