Multiple sequence alignment - TraesCS2A01G579200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G579200 chr2A 100.000 3502 0 0 1 3502 772044248 772047749 0.000000e+00 6468.0
1 TraesCS2A01G579200 chr2A 99.172 3504 26 3 1 3502 772083842 772087344 0.000000e+00 6307.0
2 TraesCS2A01G579200 chr2A 99.144 3505 25 4 1 3502 772206060 772209562 0.000000e+00 6301.0
3 TraesCS2A01G579200 chr2A 99.030 3504 23 3 1 3502 772123944 772127438 0.000000e+00 6272.0
4 TraesCS2A01G579200 chr2A 99.653 1731 5 1 1772 3502 772168470 772170199 0.000000e+00 3162.0
5 TraesCS2A01G579200 chr2A 99.220 1410 8 3 1 1408 772164264 772165672 0.000000e+00 2540.0
6 TraesCS2A01G579200 chr2A 98.638 367 5 0 1404 1770 772168014 772168380 0.000000e+00 651.0
7 TraesCS2A01G579200 chr2A 89.838 433 26 14 817 1235 772081749 772082177 1.110000e-149 540.0
8 TraesCS2A01G579200 chr2A 89.838 433 26 14 817 1235 772162171 772162599 1.110000e-149 540.0
9 TraesCS2A01G579200 chr2A 89.607 433 27 14 817 1235 772121852 772122280 5.150000e-148 534.0
10 TraesCS2A01G579200 chr2A 89.376 433 28 14 817 1235 772203967 772204395 2.390000e-146 529.0
11 TraesCS2A01G579200 chr2A 81.057 227 24 13 655 864 772081541 772081765 2.800000e-36 163.0
12 TraesCS2A01G579200 chr2A 81.057 227 24 13 655 864 772121644 772121868 2.800000e-36 163.0
13 TraesCS2A01G579200 chr2A 81.057 227 24 13 655 864 772161963 772162187 2.800000e-36 163.0
14 TraesCS2A01G579200 chr2A 81.057 227 24 13 655 864 772203759 772203983 2.800000e-36 163.0
15 TraesCS2A01G579200 chr2A 93.069 101 6 1 516 615 771998194 771998294 2.820000e-31 147.0
16 TraesCS2A01G579200 chr2A 80.976 205 21 11 655 842 771998389 771998592 2.820000e-31 147.0
17 TraesCS2A01G579200 chr2A 93.069 101 6 1 516 615 772081343 772081443 2.820000e-31 147.0
18 TraesCS2A01G579200 chr2A 93.069 101 6 1 516 615 772121446 772121546 2.820000e-31 147.0
19 TraesCS2A01G579200 chr2A 85.870 92 7 3 634 719 772081429 772081520 3.720000e-15 93.5
20 TraesCS2A01G579200 chr2A 85.870 92 7 3 634 719 772121532 772121623 3.720000e-15 93.5
21 TraesCS2A01G579200 chr2A 85.870 92 7 3 634 719 772161851 772161942 3.720000e-15 93.5
22 TraesCS2A01G579200 chr2A 85.870 92 7 3 634 719 772203647 772203738 3.720000e-15 93.5
23 TraesCS2A01G579200 chr2D 90.807 979 63 13 1753 2722 650651990 650652950 0.000000e+00 1284.0
24 TraesCS2A01G579200 chr2D 90.877 844 57 11 900 1725 650650945 650651786 0.000000e+00 1114.0
25 TraesCS2A01G579200 chr2D 86.875 160 20 1 356 515 263496432 263496590 9.990000e-41 178.0
26 TraesCS2A01G579200 chr2D 80.408 245 37 8 279 515 415456130 415456371 3.590000e-40 176.0
27 TraesCS2A01G579200 chr2D 96.040 101 3 1 516 615 650650650 650650750 2.800000e-36 163.0
28 TraesCS2A01G579200 chr2D 91.667 96 7 1 14 109 12861993 12862087 7.890000e-27 132.0
29 TraesCS2A01G579200 chr2D 88.043 92 7 1 632 719 650650734 650650825 4.780000e-19 106.0
30 TraesCS2A01G579200 chr2D 100.000 29 0 0 736 764 650650810 650650838 2.000000e-03 54.7
31 TraesCS2A01G579200 chr2B 88.979 989 66 21 1764 2722 787815796 787816771 0.000000e+00 1182.0
32 TraesCS2A01G579200 chr2B 89.904 832 57 15 900 1705 787814726 787815556 0.000000e+00 1046.0
33 TraesCS2A01G579200 chr2B 93.333 105 2 2 516 615 787814447 787814551 2.180000e-32 150.0
34 TraesCS2A01G579200 chr3B 81.683 404 46 15 116 515 757480594 757480215 9.440000e-81 311.0
35 TraesCS2A01G579200 chr3B 85.802 162 17 3 359 515 30444715 30444555 2.160000e-37 167.0
36 TraesCS2A01G579200 chr1D 85.714 168 21 2 350 515 436981463 436981629 1.290000e-39 174.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G579200 chr2A 772044248 772047749 3501 False 6468.000000 6468 100.000000 1 3502 1 chr2A.!!$F1 3501
1 TraesCS2A01G579200 chr2A 772203647 772209562 5915 False 1771.625000 6301 88.861750 1 3502 4 chr2A.!!$F6 3501
2 TraesCS2A01G579200 chr2A 772081343 772087344 6001 False 1450.100000 6307 89.801200 1 3502 5 chr2A.!!$F3 3501
3 TraesCS2A01G579200 chr2A 772121446 772127438 5992 False 1441.900000 6272 89.726600 1 3502 5 chr2A.!!$F4 3501
4 TraesCS2A01G579200 chr2A 772161851 772170199 8348 False 1191.583333 3162 92.379333 1 3502 6 chr2A.!!$F5 3501
5 TraesCS2A01G579200 chr2D 650650650 650652950 2300 False 544.340000 1284 93.153400 516 2722 5 chr2D.!!$F4 2206
6 TraesCS2A01G579200 chr2B 787814447 787816771 2324 False 792.666667 1182 90.738667 516 2722 3 chr2B.!!$F1 2206

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
190 2690 2.668212 CAAGGAGGCGGCGAACAA 60.668 61.111 12.98 0.0 0.00 2.83 F
553 3053 3.244735 TGCACTTCTACATGGCCAACTTA 60.245 43.478 10.96 0.0 0.00 2.24 F
1289 6810 0.040646 TCCCTTAGAGGTCTTCCGCA 59.959 55.000 0.00 0.0 39.05 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1289 6810 2.361357 CTCGTCCTCCAGGTCGGT 60.361 66.667 11.58 0.00 44.68 4.69 R
2281 10677 2.095415 GGAACTTGCCGTGTTTCCATAC 60.095 50.000 0.00 0.00 0.00 2.39 R
2990 11390 4.775253 ACCCACTTTTCCTGAACAGAAAAA 59.225 37.500 3.19 1.32 0.00 1.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
190 2690 2.668212 CAAGGAGGCGGCGAACAA 60.668 61.111 12.98 0.0 0.00 2.83
436 2936 6.286758 TGCAAAACATTAGGCTGAAAATCAA 58.713 32.000 0.00 0.0 0.00 2.57
553 3053 3.244735 TGCACTTCTACATGGCCAACTTA 60.245 43.478 10.96 0.0 0.00 2.24
1289 6810 0.040646 TCCCTTAGAGGTCTTCCGCA 59.959 55.000 0.00 0.0 39.05 5.69
1330 6851 3.376935 CTTCGATGAGGCCGTGGCT 62.377 63.158 11.25 0.0 42.48 4.75
1433 9300 7.285629 CACTCTGTACTAGGGTCAGATTTGATA 59.714 40.741 11.97 0.0 38.32 2.15
1469 9344 8.947115 GCACTGTTTTTAGTTGGTTATATCTCT 58.053 33.333 0.00 0.0 0.00 3.10
1530 9405 0.319986 TAACGCAATGAGGTCGTGCA 60.320 50.000 6.35 0.0 36.49 4.57
2242 10638 4.028490 CCTGGCCGCCAAGTACCA 62.028 66.667 14.45 0.0 30.80 3.25
2281 10677 0.311790 GACAGGTGTGTGCCAACATG 59.688 55.000 0.00 0.0 38.92 3.21
2990 11390 7.851387 AATTTCCGGTTGTGTTGTTTTTATT 57.149 28.000 0.00 0.0 0.00 1.40
3377 11778 0.518636 GCTGCTGCTTTCGTTCATCA 59.481 50.000 8.53 0.0 36.03 3.07
3422 11823 1.072331 ACTTCAGCATTTCCCTCACGT 59.928 47.619 0.00 0.0 0.00 4.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1 2 0.808453 ACCACACAGAACGGTCGTTG 60.808 55.000 13.65 3.68 38.60 4.10
311 2811 8.362464 TCACTATAGACAATGTTAGACTGGTT 57.638 34.615 6.78 0.00 0.00 3.67
436 2936 1.550072 CGAATTTGGGCCAGAAACCAT 59.450 47.619 6.23 0.00 36.48 3.55
553 3053 4.948621 AGACGACTGCAGGTTAGTACTATT 59.051 41.667 19.93 0.00 0.00 1.73
1289 6810 2.361357 CTCGTCCTCCAGGTCGGT 60.361 66.667 11.58 0.00 44.68 4.69
1433 9300 6.233905 ACTAAAAACAGTGCCTTTTCCATT 57.766 33.333 6.77 0.00 0.00 3.16
1469 9344 3.429547 GCTCGATCACTTCTTTCTGCCTA 60.430 47.826 0.00 0.00 0.00 3.93
1470 9345 2.676463 GCTCGATCACTTCTTTCTGCCT 60.676 50.000 0.00 0.00 0.00 4.75
1708 9799 9.425577 CGCCCTAATTAAAATTAAAAAGGAACA 57.574 29.630 14.07 0.00 33.66 3.18
2242 10638 5.953183 TGTCGGTATTGACGTTATACTGTT 58.047 37.500 20.77 0.00 41.87 3.16
2281 10677 2.095415 GGAACTTGCCGTGTTTCCATAC 60.095 50.000 0.00 0.00 0.00 2.39
2990 11390 4.775253 ACCCACTTTTCCTGAACAGAAAAA 59.225 37.500 3.19 1.32 0.00 1.94
3422 11823 0.979665 CAGAACCTGAAGAGAGGCCA 59.020 55.000 5.01 0.00 36.46 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.