Multiple sequence alignment - TraesCS2A01G536900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G536900 chr2A 100.000 3029 0 0 1 3029 750743527 750746555 0.000000e+00 5594
1 TraesCS2A01G536900 chr2A 99.316 2486 9 2 1 2485 750583033 750580555 0.000000e+00 4490
2 TraesCS2A01G536900 chr2A 99.430 1579 2 1 907 2485 750618171 750616600 0.000000e+00 2859
3 TraesCS2A01G536900 chr2A 99.564 918 4 0 1 918 750621525 750620608 0.000000e+00 1674
4 TraesCS2A01G536900 chr2A 94.881 547 26 1 2483 3029 633454364 633454908 0.000000e+00 854
5 TraesCS2A01G536900 chr2A 88.293 205 21 1 995 1199 719993370 719993571 3.020000e-60 243
6 TraesCS2A01G536900 chr2A 86.777 121 9 2 2175 2295 750615518 750615405 8.810000e-26 128
7 TraesCS2A01G536900 chr2A 85.950 121 10 4 2175 2295 750650142 750650029 4.100000e-24 122
8 TraesCS2A01G536900 chr2D 97.604 1085 17 3 445 1521 619437988 619436905 0.000000e+00 1851
9 TraesCS2A01G536900 chr2D 86.450 1262 105 31 289 1497 619428007 619426759 0.000000e+00 1323
10 TraesCS2A01G536900 chr2D 96.862 733 15 1 1676 2408 619436647 619435923 0.000000e+00 1219
11 TraesCS2A01G536900 chr2D 89.717 671 44 11 1734 2395 619426531 619425877 0.000000e+00 833
12 TraesCS2A01G536900 chr2D 98.218 449 8 0 1 449 619438483 619438035 0.000000e+00 785
13 TraesCS2A01G536900 chr2D 84.696 477 43 18 1674 2131 620614591 620615056 1.660000e-122 449
14 TraesCS2A01G536900 chr2D 89.655 290 27 3 1 289 369696493 369696780 1.720000e-97 366
15 TraesCS2A01G536900 chr2D 86.905 336 33 6 1794 2129 585861014 585861338 1.720000e-97 366
16 TraesCS2A01G536900 chr2D 79.397 398 56 18 995 1386 585860382 585860759 1.080000e-64 257
17 TraesCS2A01G536900 chr2D 98.925 93 1 0 2393 2485 619435819 619435727 1.870000e-37 167
18 TraesCS2A01G536900 chr2D 97.938 97 1 1 1550 1645 619436736 619436640 1.870000e-37 167
19 TraesCS2A01G536900 chr2D 89.623 106 10 1 1531 1636 619426661 619426557 1.890000e-27 134
20 TraesCS2A01G536900 chr2B 86.659 817 75 17 1682 2485 758147608 758146813 0.000000e+00 874
21 TraesCS2A01G536900 chr2B 89.823 678 50 12 1734 2408 758373135 758372474 0.000000e+00 852
22 TraesCS2A01G536900 chr2B 85.225 846 69 20 464 1275 758374516 758373693 0.000000e+00 819
23 TraesCS2A01G536900 chr2B 84.094 811 73 33 451 1225 758151164 758150374 0.000000e+00 732
24 TraesCS2A01G536900 chr2B 88.364 593 53 9 1682 2265 758389974 758389389 0.000000e+00 699
25 TraesCS2A01G536900 chr2B 86.275 510 38 12 782 1261 758390865 758390358 2.680000e-145 525
26 TraesCS2A01G536900 chr2B 89.815 324 20 8 1313 1636 758373497 758373187 1.310000e-108 403
27 TraesCS2A01G536900 chr2B 86.890 328 36 4 469 791 758391364 758391039 7.980000e-96 361
28 TraesCS2A01G536900 chr2B 82.118 425 26 18 1222 1636 758390362 758389978 4.870000e-83 318
29 TraesCS2A01G536900 chr2B 81.395 387 26 16 1255 1636 758147957 758147612 1.070000e-69 274
30 TraesCS2A01G536900 chr2B 94.444 162 8 1 289 449 758375127 758374966 6.480000e-62 248
31 TraesCS2A01G536900 chr2B 93.103 145 10 0 313 457 758391595 758391451 2.370000e-51 213
32 TraesCS2A01G536900 chr7A 95.229 545 26 0 2483 3027 645517271 645516727 0.000000e+00 863
33 TraesCS2A01G536900 chr7A 94.322 546 31 0 2483 3028 38881378 38880833 0.000000e+00 837
34 TraesCS2A01G536900 chr7A 94.150 547 32 0 2483 3029 542684722 542685268 0.000000e+00 833
35 TraesCS2A01G536900 chr7A 90.244 287 26 2 4 289 39236107 39235822 1.030000e-99 374
36 TraesCS2A01G536900 chr4A 95.064 547 27 0 2483 3029 500406001 500406547 0.000000e+00 861
37 TraesCS2A01G536900 chr5A 94.545 550 28 2 2479 3028 592147191 592147738 0.000000e+00 848
38 TraesCS2A01G536900 chr5A 94.526 548 29 1 2483 3029 94813582 94814129 0.000000e+00 845
39 TraesCS2A01G536900 chr1A 94.516 547 29 1 2483 3029 380605866 380606411 0.000000e+00 843
40 TraesCS2A01G536900 chr1A 90.244 287 26 2 4 289 353653178 353652893 1.030000e-99 374
41 TraesCS2A01G536900 chr6A 94.150 547 32 0 2483 3029 577576695 577576149 0.000000e+00 833
42 TraesCS2A01G536900 chr6D 91.034 290 24 2 1 289 456686946 456686658 1.020000e-104 390
43 TraesCS2A01G536900 chr4B 91.034 290 24 2 1 289 551071598 551071886 1.020000e-104 390
44 TraesCS2A01G536900 chr3B 89.691 291 27 3 1 289 99089897 99090186 4.770000e-98 368


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G536900 chr2A 750743527 750746555 3028 False 5594.000000 5594 100.000000 1 3029 1 chr2A.!!$F3 3028
1 TraesCS2A01G536900 chr2A 750580555 750583033 2478 True 4490.000000 4490 99.316000 1 2485 1 chr2A.!!$R1 2484
2 TraesCS2A01G536900 chr2A 750615405 750621525 6120 True 1553.666667 2859 95.257000 1 2485 3 chr2A.!!$R3 2484
3 TraesCS2A01G536900 chr2A 633454364 633454908 544 False 854.000000 854 94.881000 2483 3029 1 chr2A.!!$F1 546
4 TraesCS2A01G536900 chr2D 619435727 619438483 2756 True 837.800000 1851 97.909400 1 2485 5 chr2D.!!$R2 2484
5 TraesCS2A01G536900 chr2D 619425877 619428007 2130 True 763.333333 1323 88.596667 289 2395 3 chr2D.!!$R1 2106
6 TraesCS2A01G536900 chr2D 585860382 585861338 956 False 311.500000 366 83.151000 995 2129 2 chr2D.!!$F3 1134
7 TraesCS2A01G536900 chr2B 758146813 758151164 4351 True 626.666667 874 84.049333 451 2485 3 chr2B.!!$R1 2034
8 TraesCS2A01G536900 chr2B 758372474 758375127 2653 True 580.500000 852 89.826750 289 2408 4 chr2B.!!$R2 2119
9 TraesCS2A01G536900 chr2B 758389389 758391595 2206 True 423.200000 699 87.350000 313 2265 5 chr2B.!!$R3 1952
10 TraesCS2A01G536900 chr7A 645516727 645517271 544 True 863.000000 863 95.229000 2483 3027 1 chr7A.!!$R3 544
11 TraesCS2A01G536900 chr7A 38880833 38881378 545 True 837.000000 837 94.322000 2483 3028 1 chr7A.!!$R1 545
12 TraesCS2A01G536900 chr7A 542684722 542685268 546 False 833.000000 833 94.150000 2483 3029 1 chr7A.!!$F1 546
13 TraesCS2A01G536900 chr4A 500406001 500406547 546 False 861.000000 861 95.064000 2483 3029 1 chr4A.!!$F1 546
14 TraesCS2A01G536900 chr5A 592147191 592147738 547 False 848.000000 848 94.545000 2479 3028 1 chr5A.!!$F2 549
15 TraesCS2A01G536900 chr5A 94813582 94814129 547 False 845.000000 845 94.526000 2483 3029 1 chr5A.!!$F1 546
16 TraesCS2A01G536900 chr1A 380605866 380606411 545 False 843.000000 843 94.516000 2483 3029 1 chr1A.!!$F1 546
17 TraesCS2A01G536900 chr6A 577576149 577576695 546 True 833.000000 833 94.150000 2483 3029 1 chr6A.!!$R1 546

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
714 1190 1.087202 GCGGCAACATGTCATCCGTA 61.087 55.0 24.54 0.0 41.89 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2562 8684 2.67945 CGTGATACGGGAGTCAAAACA 58.321 47.619 0.0 0.0 45.66 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 247 4.459685 ACCGTGATAGTCATAGAGGCATAC 59.540 45.833 0.00 0.0 0.00 2.39
714 1190 1.087202 GCGGCAACATGTCATCCGTA 61.087 55.000 24.54 0.0 41.89 4.02
1755 7653 5.847670 AGCGAAAAACAGATAGTCAAGTC 57.152 39.130 0.00 0.0 0.00 3.01
2530 8652 9.393249 CGTTTTCTTACATGACACATATTTTGT 57.607 29.630 0.00 0.0 39.91 2.83
2688 8810 3.147595 TCTCATCCGGCACCGAGG 61.148 66.667 11.42 0.0 42.83 4.63
2791 8913 2.103373 TGGAGGAGGATCAAGAAGTCG 58.897 52.381 0.00 0.0 36.25 4.18
2793 8915 0.827368 AGGAGGATCAAGAAGTCGCC 59.173 55.000 0.00 0.0 36.25 5.54
2798 8920 0.537188 GATCAAGAAGTCGCCTCCCA 59.463 55.000 0.00 0.0 0.00 4.37
2832 9353 0.187117 TCACAATGGGGGAACTGCAA 59.813 50.000 0.00 0.0 0.00 4.08
2862 9383 2.793288 TTCCAAACTCGGTTATCCCC 57.207 50.000 0.00 0.0 0.00 4.81
2878 9399 6.839134 GGTTATCCCCTCCAATGTTAGATTTT 59.161 38.462 0.00 0.0 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 247 6.142817 CACCGATAAGGACTTTGAGTTTTTG 58.857 40.000 0.00 0.00 45.00 2.44
714 1190 1.964223 AGCTCCATCGGTTATGATCGT 59.036 47.619 0.00 0.00 37.86 3.73
1182 4310 1.372499 GCCACTCACGAGCGTGTAA 60.372 57.895 20.71 3.83 45.55 2.41
1755 7653 6.589454 GCAAAAAGTTTGATTAATGGTTCCG 58.411 36.000 4.93 0.00 0.00 4.30
2540 8662 9.449719 AAACATCCGGGAGATTATATAATGAAC 57.550 33.333 12.74 4.17 30.59 3.18
2562 8684 2.679450 CGTGATACGGGAGTCAAAACA 58.321 47.619 0.00 0.00 45.66 2.83
2688 8810 6.237808 GGTCAACATTGTTGTTTGTCATTGAC 60.238 38.462 24.71 9.93 43.57 3.18
2791 8913 3.394836 AGCTCGGAAGTGGGAGGC 61.395 66.667 0.00 0.00 0.00 4.70
2793 8915 1.984570 TCCAGCTCGGAAGTGGGAG 60.985 63.158 2.78 0.00 42.52 4.30
2832 9353 2.633488 GAGTTTGGAATAGCCGAGCTT 58.367 47.619 3.71 0.00 41.32 3.74
2906 9428 2.046892 CTGCGGGAGAACCAGTGG 60.047 66.667 7.91 7.91 40.22 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.