Multiple sequence alignment - TraesCS2A01G536800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G536800 chr2A 100.000 2556 0 0 1 2556 750632244 750634799 0.000000e+00 4721.0
1 TraesCS2A01G536800 chr2A 98.201 2557 24 3 1 2556 750593785 750596320 0.000000e+00 4447.0
2 TraesCS2A01G536800 chr2A 99.289 2109 15 0 1 2109 750570231 750572339 0.000000e+00 3812.0
3 TraesCS2A01G536800 chr2A 85.398 1582 158 25 1 1558 750563939 750565471 0.000000e+00 1574.0
4 TraesCS2A01G536800 chr2A 98.020 303 4 1 2256 2556 750572552 750572854 2.250000e-145 525.0
5 TraesCS2A01G536800 chr2A 94.444 36 0 2 1881 1916 691231892 691231925 1.000000e-03 54.7
6 TraesCS2A01G536800 chr2D 96.939 1895 55 2 1 1894 619414793 619416685 0.000000e+00 3175.0
7 TraesCS2A01G536800 chr2D 85.920 1598 152 23 1 1558 619410117 619411681 0.000000e+00 1637.0
8 TraesCS2A01G536800 chr2D 88.994 636 43 22 1924 2554 619416651 619417264 0.000000e+00 761.0
9 TraesCS2A01G536800 chr2D 78.213 817 123 33 137 924 619499346 619498556 2.980000e-129 472.0
10 TraesCS2A01G536800 chr2B 88.072 2163 182 65 318 2454 758123897 758126009 0.000000e+00 2495.0
11 TraesCS2A01G536800 chr2B 84.896 1589 161 20 1 1558 758117382 758118922 0.000000e+00 1531.0
12 TraesCS2A01G536800 chr2B 83.008 1589 159 48 19 1558 758794674 758793148 0.000000e+00 1336.0
13 TraesCS2A01G536800 chr2B 85.191 1175 123 31 798 1953 758383957 758385099 0.000000e+00 1158.0
14 TraesCS2A01G536800 chr2B 79.672 915 124 39 82 954 757270094 757270988 1.010000e-168 603.0
15 TraesCS2A01G536800 chr2B 92.284 324 25 0 1 324 758123535 758123858 6.440000e-126 460.0
16 TraesCS2A01G536800 chr2B 84.348 230 34 2 696 924 758899128 758899356 9.200000e-55 224.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G536800 chr2A 750632244 750634799 2555 False 4721.000000 4721 100.000000 1 2556 1 chr2A.!!$F4 2555
1 TraesCS2A01G536800 chr2A 750593785 750596320 2535 False 4447.000000 4447 98.201000 1 2556 1 chr2A.!!$F3 2555
2 TraesCS2A01G536800 chr2A 750570231 750572854 2623 False 2168.500000 3812 98.654500 1 2556 2 chr2A.!!$F5 2555
3 TraesCS2A01G536800 chr2A 750563939 750565471 1532 False 1574.000000 1574 85.398000 1 1558 1 chr2A.!!$F2 1557
4 TraesCS2A01G536800 chr2D 619410117 619417264 7147 False 1857.666667 3175 90.617667 1 2554 3 chr2D.!!$F1 2553
5 TraesCS2A01G536800 chr2D 619498556 619499346 790 True 472.000000 472 78.213000 137 924 1 chr2D.!!$R1 787
6 TraesCS2A01G536800 chr2B 758117382 758118922 1540 False 1531.000000 1531 84.896000 1 1558 1 chr2B.!!$F2 1557
7 TraesCS2A01G536800 chr2B 758123535 758126009 2474 False 1477.500000 2495 90.178000 1 2454 2 chr2B.!!$F5 2453
8 TraesCS2A01G536800 chr2B 758793148 758794674 1526 True 1336.000000 1336 83.008000 19 1558 1 chr2B.!!$R1 1539
9 TraesCS2A01G536800 chr2B 758383957 758385099 1142 False 1158.000000 1158 85.191000 798 1953 1 chr2B.!!$F3 1155
10 TraesCS2A01G536800 chr2B 757270094 757270988 894 False 603.000000 603 79.672000 82 954 1 chr2B.!!$F1 872

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
405 5148 2.310052 AGGCTTAGCAAGGGTTCTGATT 59.69 45.455 6.53 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2001 6838 9.897744 ACATGTTGATTGTTTATACACTCTTTG 57.102 29.63 0.0 1.96 35.58 2.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
281 4969 9.406828 GTTTTGGCAAAGTCTATAAGGTTTTAG 57.593 33.333 13.04 0.0 0.00 1.85
405 5148 2.310052 AGGCTTAGCAAGGGTTCTGATT 59.690 45.455 6.53 0.0 0.00 2.57
545 5288 2.757894 TACCCAACAAAAGCCTGGAA 57.242 45.000 0.00 0.0 31.38 3.53
610 5354 5.926894 TCGAAAGTAATCTCGAATTGACG 57.073 39.130 0.00 0.0 40.89 4.35
853 5626 7.903995 TGAACCCAAAAATATCAGATTTTGC 57.096 32.000 5.66 0.0 42.41 3.68
934 5707 5.344396 GCACGTAGTAAGTACTTCTTCAACC 59.656 44.000 12.39 0.0 41.61 3.77
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
126 127 1.455849 CTCAGGTGTTTCAGGGCCA 59.544 57.895 6.18 0.00 0.00 5.36
405 5148 8.275187 TCATTTCTAAAATGCTCTATCCCCTA 57.725 34.615 7.39 0.00 0.00 3.53
545 5288 9.797556 GTTTAGAACATACCAAAAAGAAACTGT 57.202 29.630 0.00 0.00 0.00 3.55
610 5354 5.198274 CGTTCAGACAAGTAAGTTTGCTTC 58.802 41.667 0.00 0.00 36.22 3.86
853 5626 1.483415 CCCCAAAGATCCTTGCCATTG 59.517 52.381 0.00 0.00 0.00 2.82
992 5787 1.945354 CTCAGGCGACATGTACCCGT 61.945 60.000 12.66 0.00 0.00 5.28
2001 6838 9.897744 ACATGTTGATTGTTTATACACTCTTTG 57.102 29.630 0.00 1.96 35.58 2.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.