Multiple sequence alignment - TraesCS2A01G529200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G529200 chr2A 100.000 2402 0 0 1 2402 747722170 747719769 0 4436
1 TraesCS2A01G529200 chr2A 99.001 2403 21 3 1 2402 747778417 747776017 0 4301
2 TraesCS2A01G529200 chr2A 98.876 2403 25 2 1 2402 747814586 747812185 0 4287
3 TraesCS2A01G529200 chr2A 98.545 2405 29 5 1 2402 747741146 747738745 0 4242
4 TraesCS2A01G529200 chr2A 98.544 2404 30 4 1 2402 747731633 747729233 0 4241
5 TraesCS2A01G529200 chr2A 98.461 2404 31 5 1 2402 747737957 747735558 0 4229
6 TraesCS2A01G529200 chr2A 96.053 2407 87 6 1 2402 747820915 747818512 0 3912
7 TraesCS2A01G529200 chr2A 95.887 2407 91 6 1 2402 747747988 747745585 0 3890
8 TraesCS2A01G529200 chr2A 95.806 2408 92 7 1 2402 747784746 747782342 0 3879
9 TraesCS2A01G529200 chr2A 92.899 2408 157 12 1 2402 747876187 747873788 0 3487


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G529200 chr2A 747719769 747722170 2401 True 4436.000000 4436 100.000000 1 2402 1 chr2A.!!$R1 2401
1 TraesCS2A01G529200 chr2A 747729233 747741146 11913 True 4237.333333 4242 98.516667 1 2402 3 chr2A.!!$R4 2401
2 TraesCS2A01G529200 chr2A 747812185 747820915 8730 True 4099.500000 4287 97.464500 1 2402 2 chr2A.!!$R6 2401
3 TraesCS2A01G529200 chr2A 747776017 747784746 8729 True 4090.000000 4301 97.403500 1 2402 2 chr2A.!!$R5 2401
4 TraesCS2A01G529200 chr2A 747745585 747747988 2403 True 3890.000000 3890 95.887000 1 2402 1 chr2A.!!$R2 2401
5 TraesCS2A01G529200 chr2A 747873788 747876187 2399 True 3487.000000 3487 92.899000 1 2402 1 chr2A.!!$R3 2401

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
923 929 2.423577 ACAATTTCACAGGCGTCCTAC 58.576 47.619 0.0 0.0 29.64 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1790 8123 2.912956 ACTAGAGCCTGTGATGGGAAAA 59.087 45.455 0.0 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
455 459 5.709164 GCCCAATCTTTACATGCTCATATCT 59.291 40.000 0.00 0.0 0.00 1.98
923 929 2.423577 ACAATTTCACAGGCGTCCTAC 58.576 47.619 0.00 0.0 29.64 3.18
1036 1042 3.258123 CACCAAACCCATAAAACCCTCTG 59.742 47.826 0.00 0.0 0.00 3.35
1050 1056 1.204113 CCTCTGGTGGCCTCCTTCTT 61.204 60.000 23.90 0.0 0.00 2.52
1112 1118 1.593296 GACGACCTACCGCCTTCACT 61.593 60.000 0.00 0.0 0.00 3.41
1391 7724 3.254166 CACAACCAATTCTGTCTCCAAGG 59.746 47.826 0.00 0.0 0.00 3.61
1404 7737 1.912043 CTCCAAGGATCTGGGTGAACT 59.088 52.381 1.40 0.0 37.06 3.01
1488 7821 5.528690 GCATCAACACATGTACATCACCTAT 59.471 40.000 5.07 0.0 0.00 2.57
1492 7825 9.851686 ATCAACACATGTACATCACCTATAATT 57.148 29.630 5.07 0.0 0.00 1.40
1789 8122 6.935208 GTGAATTTGTGAGGGTAGTAGAAACT 59.065 38.462 0.00 0.0 39.91 2.66
1790 8123 7.444487 GTGAATTTGTGAGGGTAGTAGAAACTT 59.556 37.037 0.00 0.0 37.15 2.66
2028 8361 4.705023 ACCCAACTAATCCAAATACACTGC 59.295 41.667 0.00 0.0 0.00 4.40
2035 8368 8.668510 ACTAATCCAAATACACTGCTAATGAG 57.331 34.615 0.00 0.0 0.00 2.90
2168 8501 7.361457 TGGTCTTAGGAAACTACCTCATATG 57.639 40.000 0.00 0.0 44.30 1.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
455 459 6.262273 GGACCCATTCTTAAATATTTGAGCGA 59.738 38.462 13.69 6.69 0.00 4.93
677 682 6.491062 TCCACATTCTCACAGTTTTTCATGAT 59.509 34.615 0.00 0.00 0.00 2.45
681 686 4.946772 TGTCCACATTCTCACAGTTTTTCA 59.053 37.500 0.00 0.00 0.00 2.69
923 929 6.529125 GTGCAGACTTGGAATGTATCAATTTG 59.471 38.462 0.00 0.00 0.00 2.32
1036 1042 1.340991 TGCAATAAGAAGGAGGCCACC 60.341 52.381 11.96 11.96 0.00 4.61
1050 1056 5.782331 AGACATAGCTAGGAGGATTGCAATA 59.218 40.000 12.97 0.00 0.00 1.90
1127 1133 3.716195 CACCGACTGGGGATGGCA 61.716 66.667 0.00 0.00 43.62 4.92
1176 1182 1.210870 GGACGTTCACGCACACTTTA 58.789 50.000 0.00 0.00 44.43 1.85
1391 7724 2.769095 AGGCTAGAAGTTCACCCAGATC 59.231 50.000 5.50 0.00 0.00 2.75
1404 7737 0.738975 CGTCATCGGTGAGGCTAGAA 59.261 55.000 5.30 0.00 34.36 2.10
1584 7917 6.483640 GCGGATTCTTATTTAGATGACCACTT 59.516 38.462 0.00 0.00 31.54 3.16
1705 8038 4.037565 TGAACTTTTGAGCTAGACGAGTCA 59.962 41.667 5.99 0.00 0.00 3.41
1789 8122 2.978156 AGAGCCTGTGATGGGAAAAA 57.022 45.000 0.00 0.00 0.00 1.94
1790 8123 2.912956 ACTAGAGCCTGTGATGGGAAAA 59.087 45.455 0.00 0.00 0.00 2.29
1845 8178 6.005066 TGTGTGGTCATTCATATCCTTGAT 57.995 37.500 0.00 0.00 0.00 2.57
2168 8501 3.392882 CCTTTTTGCATGTCAAACCTCC 58.607 45.455 12.78 0.00 43.76 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.