Multiple sequence alignment - TraesCS2A01G511800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G511800 chr2A 100.000 3266 0 0 1 3266 736454924 736451659 0.000000e+00 6032.0
1 TraesCS2A01G511800 chr2A 99.452 2737 15 0 530 3266 620706794 620709530 0.000000e+00 4972.0
2 TraesCS2A01G511800 chr2A 95.387 1344 53 6 733 2074 21215527 21216863 0.000000e+00 2130.0
3 TraesCS2A01G511800 chr2A 95.779 995 34 3 2158 3152 21218121 21219107 0.000000e+00 1598.0
4 TraesCS2A01G511800 chr2A 95.949 790 28 3 1 789 21214858 21215644 0.000000e+00 1279.0
5 TraesCS2A01G511800 chr6B 99.418 3266 19 0 1 3266 707180156 707176891 0.000000e+00 5927.0
6 TraesCS2A01G511800 chr6B 97.385 1109 29 0 2158 3266 11701799 11700691 0.000000e+00 1888.0
7 TraesCS2A01G511800 chr6B 100.000 43 0 0 2071 2113 11701972 11701930 2.700000e-11 80.5
8 TraesCS2A01G511800 chr7B 95.908 1344 49 4 733 2074 585480075 585478736 0.000000e+00 2172.0
9 TraesCS2A01G511800 chr7B 95.879 995 34 4 2158 3152 585477479 585476492 0.000000e+00 1604.0
10 TraesCS2A01G511800 chr7B 96.456 790 26 2 1 789 585480744 585479956 0.000000e+00 1303.0
11 TraesCS2A01G511800 chr2B 95.210 1357 59 4 647 2001 576685616 576684264 0.000000e+00 2141.0
12 TraesCS2A01G511800 chr2B 98.305 118 2 0 138 255 721700545 721700662 1.190000e-49 207.0
13 TraesCS2A01G511800 chr2B 97.436 39 1 0 2071 2109 109404492 109404530 2.100000e-07 67.6
14 TraesCS2A01G511800 chrUn 95.210 1357 58 5 647 2001 38658884 38660235 0.000000e+00 2139.0
15 TraesCS2A01G511800 chrUn 97.397 999 21 3 1077 2074 316936553 316937547 0.000000e+00 1696.0
16 TraesCS2A01G511800 chrUn 96.080 995 36 2 2158 3152 316938806 316939797 0.000000e+00 1618.0
17 TraesCS2A01G511800 chrUn 95.879 995 38 2 2158 3152 379280354 379279363 0.000000e+00 1607.0
18 TraesCS2A01G511800 chrUn 94.933 375 15 3 416 789 431333004 431333375 4.700000e-163 584.0
19 TraesCS2A01G511800 chrUn 97.321 336 9 0 1 336 345821661 345821996 3.660000e-159 571.0
20 TraesCS2A01G511800 chr1B 94.912 1356 64 3 647 2001 32422892 32424243 0.000000e+00 2117.0
21 TraesCS2A01G511800 chr5B 92.994 1356 72 15 647 2001 591688175 591686842 0.000000e+00 1956.0
22 TraesCS2A01G511800 chr5A 95.455 880 36 2 2238 3117 78916001 78915126 0.000000e+00 1400.0
23 TraesCS2A01G511800 chr5A 95.455 880 36 2 2238 3117 395306238 395307113 0.000000e+00 1400.0
24 TraesCS2A01G511800 chr5A 97.938 97 2 0 476 572 458334559 458334655 5.600000e-38 169.0
25 TraesCS2A01G511800 chr3B 94.118 272 12 1 425 696 42497130 42497397 8.430000e-111 411.0
26 TraesCS2A01G511800 chr3B 83.882 304 26 10 657 938 9284424 9284726 5.370000e-68 268.0
27 TraesCS2A01G511800 chr3B 91.971 137 11 0 2158 2294 769483121 769483257 3.330000e-45 193.0
28 TraesCS2A01G511800 chr3B 97.938 97 2 0 476 572 769481619 769481715 5.600000e-38 169.0
29 TraesCS2A01G511800 chr3B 92.105 76 6 0 2158 2233 9285830 9285905 1.240000e-19 108.0
30 TraesCS2A01G511800 chr4A 98.319 119 1 1 138 255 622189690 622189808 1.190000e-49 207.0
31 TraesCS2A01G511800 chr7A 98.969 97 1 0 476 572 66646200 66646104 1.200000e-39 174.0
32 TraesCS2A01G511800 chr7A 79.310 87 9 5 3150 3236 736336649 736336572 6.000000e-03 52.8
33 TraesCS2A01G511800 chr6A 97.938 97 2 0 476 572 15465692 15465788 5.600000e-38 169.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G511800 chr2A 736451659 736454924 3265 True 6032.00 6032 100.0000 1 3266 1 chr2A.!!$R1 3265
1 TraesCS2A01G511800 chr2A 620706794 620709530 2736 False 4972.00 4972 99.4520 530 3266 1 chr2A.!!$F1 2736
2 TraesCS2A01G511800 chr2A 21214858 21219107 4249 False 1669.00 2130 95.7050 1 3152 3 chr2A.!!$F2 3151
3 TraesCS2A01G511800 chr6B 707176891 707180156 3265 True 5927.00 5927 99.4180 1 3266 1 chr6B.!!$R1 3265
4 TraesCS2A01G511800 chr6B 11700691 11701972 1281 True 984.25 1888 98.6925 2071 3266 2 chr6B.!!$R2 1195
5 TraesCS2A01G511800 chr7B 585476492 585480744 4252 True 1693.00 2172 96.0810 1 3152 3 chr7B.!!$R1 3151
6 TraesCS2A01G511800 chr2B 576684264 576685616 1352 True 2141.00 2141 95.2100 647 2001 1 chr2B.!!$R1 1354
7 TraesCS2A01G511800 chrUn 38658884 38660235 1351 False 2139.00 2139 95.2100 647 2001 1 chrUn.!!$F1 1354
8 TraesCS2A01G511800 chrUn 316936553 316939797 3244 False 1657.00 1696 96.7385 1077 3152 2 chrUn.!!$F4 2075
9 TraesCS2A01G511800 chrUn 379279363 379280354 991 True 1607.00 1607 95.8790 2158 3152 1 chrUn.!!$R1 994
10 TraesCS2A01G511800 chr1B 32422892 32424243 1351 False 2117.00 2117 94.9120 647 2001 1 chr1B.!!$F1 1354
11 TraesCS2A01G511800 chr5B 591686842 591688175 1333 True 1956.00 1956 92.9940 647 2001 1 chr5B.!!$R1 1354
12 TraesCS2A01G511800 chr5A 78915126 78916001 875 True 1400.00 1400 95.4550 2238 3117 1 chr5A.!!$R1 879
13 TraesCS2A01G511800 chr5A 395306238 395307113 875 False 1400.00 1400 95.4550 2238 3117 1 chr5A.!!$F1 879

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
347 348 2.805099 GTCAAGTGAGCCAAGTCTTCTG 59.195 50.0 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2265 3446 1.509923 CCGACCTCTGACGTAACCC 59.49 63.158 0.0 0.0 0.0 4.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
347 348 2.805099 GTCAAGTGAGCCAAGTCTTCTG 59.195 50.000 0.00 0.0 0.00 3.02
670 671 6.097129 TGTGTTGTATCGGGTTATATGTCTCA 59.903 38.462 0.00 0.0 0.00 3.27
1248 1250 0.685660 TTACACGGTACCATGCACCA 59.314 50.000 8.14 0.0 35.67 4.17
1249 1251 0.906066 TACACGGTACCATGCACCAT 59.094 50.000 8.14 0.0 35.67 3.55
2265 3446 3.070018 GCATGTGCTAGGTAAGGCATAG 58.930 50.000 0.00 0.0 40.66 2.23
2369 3550 4.018050 AGTGGAAGAATTGGCCTCTACAAT 60.018 41.667 3.32 0.0 40.07 2.71
2533 3714 2.224548 GGGCTAGGTTTCACAACTGAGT 60.225 50.000 0.00 0.0 32.90 3.41
2987 4171 3.824133 TCTTCTGATGGCAATGGTATGG 58.176 45.455 0.00 0.0 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
347 348 6.148150 TCCCTTCAATTTTGTATCACGTACAC 59.852 38.462 0.0 0.0 42.82 2.90
2009 2015 5.649395 CCCATTGCTTAATCTCTCTCAACAA 59.351 40.000 0.0 0.0 0.00 2.83
2265 3446 1.509923 CCGACCTCTGACGTAACCC 59.490 63.158 0.0 0.0 0.00 4.11
2987 4171 2.550830 TGAAGGAGAGGCAAACTGAC 57.449 50.000 0.0 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.