Multiple sequence alignment - TraesCS2A01G510600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G510600 chr2A 100.000 2285 0 0 1 2285 735700140 735697856 0.000000e+00 4220.0
1 TraesCS2A01G510600 chr2B 92.145 2177 128 18 138 2285 391356858 391354696 0.000000e+00 3033.0
2 TraesCS2A01G510600 chr2B 93.151 73 5 0 1 73 391357213 391357141 8.630000e-20 108.0
3 TraesCS2A01G510600 chr7B 92.025 1768 47 20 556 2285 730143651 730141940 0.000000e+00 2398.0
4 TraesCS2A01G510600 chr7B 90.023 441 34 3 1 433 730144592 730144154 1.530000e-156 562.0
5 TraesCS2A01G510600 chr7B 85.849 530 64 8 1090 1616 708132919 708133440 9.220000e-154 553.0
6 TraesCS2A01G510600 chr7B 87.373 491 50 8 1797 2285 708133517 708133997 9.220000e-154 553.0
7 TraesCS2A01G510600 chr7B 76.974 152 31 3 80 231 726579090 726578943 1.450000e-12 84.2
8 TraesCS2A01G510600 chr1B 91.875 1760 50 19 564 2285 614187675 614185971 0.000000e+00 2372.0
9 TraesCS2A01G510600 chr1B 90.698 473 34 3 1 465 614188542 614188072 2.490000e-174 621.0
10 TraesCS2A01G510600 chr1B 83.945 218 32 3 625 842 303072756 303072542 2.980000e-49 206.0
11 TraesCS2A01G510600 chr1D 97.126 1392 16 11 910 2285 436604057 436605440 0.000000e+00 2327.0
12 TraesCS2A01G510600 chr1D 95.519 915 36 3 1 911 436603062 436603975 0.000000e+00 1458.0
13 TraesCS2A01G510600 chr1D 72.744 554 127 17 80 630 416135486 416134954 5.050000e-37 165.0
14 TraesCS2A01G510600 chr7D 90.615 1609 96 16 302 1878 524442581 524444166 0.000000e+00 2084.0
15 TraesCS2A01G510600 chr6D 90.397 1614 97 14 302 1878 23618440 23616848 0.000000e+00 2069.0
16 TraesCS2A01G510600 chr3D 90.199 1612 101 13 302 1878 91978226 91976637 0.000000e+00 2049.0
17 TraesCS2A01G510600 chr3D 91.928 669 27 7 1222 1878 472315291 472314638 0.000000e+00 911.0
18 TraesCS2A01G510600 chr3D 90.494 526 47 3 302 826 472316349 472315826 0.000000e+00 691.0
19 TraesCS2A01G510600 chr3D 89.398 349 22 1 891 1224 472315797 472315449 2.100000e-115 425.0
20 TraesCS2A01G510600 chr6A 95.471 552 23 2 1735 2285 566689628 566690178 0.000000e+00 880.0
21 TraesCS2A01G510600 chr5B 87.602 492 44 11 1797 2285 334895908 334895431 2.560000e-154 555.0
22 TraesCS2A01G510600 chr5B 72.464 552 132 17 77 622 286881845 286882382 2.350000e-35 159.0
23 TraesCS2A01G510600 chr3B 82.305 486 74 11 1805 2285 658389677 658390155 5.870000e-111 411.0
24 TraesCS2A01G510600 chr4B 81.391 489 72 15 1805 2285 175902162 175901685 4.610000e-102 381.0
25 TraesCS2A01G510600 chr4D 95.238 147 7 0 1660 1806 8132526 8132380 1.360000e-57 233.0
26 TraesCS2A01G510600 chr4A 73.913 552 123 17 80 625 11732874 11732338 3.850000e-48 202.0
27 TraesCS2A01G510600 chr5D 73.732 552 118 21 80 622 562055157 562055690 8.330000e-45 191.0
28 TraesCS2A01G510600 chr1A 71.585 549 135 18 80 622 238870878 238871411 1.840000e-26 130.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G510600 chr2A 735697856 735700140 2284 True 4220.000000 4220 100.000000 1 2285 1 chr2A.!!$R1 2284
1 TraesCS2A01G510600 chr2B 391354696 391357213 2517 True 1570.500000 3033 92.648000 1 2285 2 chr2B.!!$R1 2284
2 TraesCS2A01G510600 chr7B 730141940 730144592 2652 True 1480.000000 2398 91.024000 1 2285 2 chr7B.!!$R2 2284
3 TraesCS2A01G510600 chr7B 708132919 708133997 1078 False 553.000000 553 86.611000 1090 2285 2 chr7B.!!$F1 1195
4 TraesCS2A01G510600 chr1B 614185971 614188542 2571 True 1496.500000 2372 91.286500 1 2285 2 chr1B.!!$R2 2284
5 TraesCS2A01G510600 chr1D 436603062 436605440 2378 False 1892.500000 2327 96.322500 1 2285 2 chr1D.!!$F1 2284
6 TraesCS2A01G510600 chr7D 524442581 524444166 1585 False 2084.000000 2084 90.615000 302 1878 1 chr7D.!!$F1 1576
7 TraesCS2A01G510600 chr6D 23616848 23618440 1592 True 2069.000000 2069 90.397000 302 1878 1 chr6D.!!$R1 1576
8 TraesCS2A01G510600 chr3D 91976637 91978226 1589 True 2049.000000 2049 90.199000 302 1878 1 chr3D.!!$R1 1576
9 TraesCS2A01G510600 chr3D 472314638 472316349 1711 True 675.666667 911 90.606667 302 1878 3 chr3D.!!$R2 1576
10 TraesCS2A01G510600 chr6A 566689628 566690178 550 False 880.000000 880 95.471000 1735 2285 1 chr6A.!!$F1 550
11 TraesCS2A01G510600 chr4A 11732338 11732874 536 True 202.000000 202 73.913000 80 625 1 chr4A.!!$R1 545

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
176 395 1.987855 CTAGGGGTCTTGTCGGGCA 60.988 63.158 0.0 0.0 0.0 5.36 F
586 1188 4.517453 CACGGTTTTTGATGGAGGTTCTTA 59.483 41.667 0.0 0.0 0.0 2.10 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1176 1891 0.034337 TACGTTGGTGAGAACCTGCC 59.966 55.000 0.00 0.0 0.00 4.85 R
1904 2845 4.301072 TTTCAGGTCAGACCCCAAATAG 57.699 45.455 16.72 0.0 39.75 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 361 3.145551 CTACCACCCCTCGTCCCG 61.146 72.222 0.0 0.0 0.00 5.14
176 395 1.987855 CTAGGGGTCTTGTCGGGCA 60.988 63.158 0.0 0.0 0.00 5.36
586 1188 4.517453 CACGGTTTTTGATGGAGGTTCTTA 59.483 41.667 0.0 0.0 0.00 2.10
587 1189 5.183140 CACGGTTTTTGATGGAGGTTCTTAT 59.817 40.000 0.0 0.0 0.00 1.73
758 1361 6.914215 ACAGAATGATTTGCTAAATATGCACG 59.086 34.615 0.0 0.0 39.69 5.34
1292 2167 7.390027 ACATGGCTTTGTATATAGACTCATCC 58.610 38.462 0.0 0.0 0.00 3.51
1293 2168 7.236432 ACATGGCTTTGTATATAGACTCATCCT 59.764 37.037 0.0 0.0 0.00 3.24
1294 2169 7.618019 TGGCTTTGTATATAGACTCATCCTT 57.382 36.000 0.0 0.0 0.00 3.36
1295 2170 8.721133 TGGCTTTGTATATAGACTCATCCTTA 57.279 34.615 0.0 0.0 0.00 2.69
1296 2171 9.154632 TGGCTTTGTATATAGACTCATCCTTAA 57.845 33.333 0.0 0.0 0.00 1.85
1297 2172 9.425577 GGCTTTGTATATAGACTCATCCTTAAC 57.574 37.037 0.0 0.0 0.00 2.01
1298 2173 9.982651 GCTTTGTATATAGACTCATCCTTAACA 57.017 33.333 0.0 0.0 0.00 2.41
1904 2845 5.851177 CGATCACACACAACAAGGAAATAAC 59.149 40.000 0.0 0.0 0.00 1.89
2148 3093 5.048782 GCACAAACTTCAGAACCATACATGA 60.049 40.000 0.0 0.0 0.00 3.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 4.634012 TGTAAAGGCAGTGTCTTGGTAT 57.366 40.909 11.49 0.0 0.00 2.73
198 417 2.366972 GGGAGAAGGCCCCTGCTA 60.367 66.667 12.75 0.0 42.62 3.49
260 480 1.146041 CCCCGCCGAATCTTCATCA 59.854 57.895 0.00 0.0 0.00 3.07
288 508 2.113433 CACTCGTCGTCGGGATCCT 61.113 63.158 12.58 0.0 40.39 3.24
586 1188 2.421529 GGTTTTCACCCGGATCTGCTAT 60.422 50.000 0.73 0.0 37.03 2.97
587 1189 1.065709 GGTTTTCACCCGGATCTGCTA 60.066 52.381 0.73 0.0 37.03 3.49
758 1361 6.803807 GTGTTGTAGGCAGATTCATTTTTCTC 59.196 38.462 0.00 0.0 0.00 2.87
1176 1891 0.034337 TACGTTGGTGAGAACCTGCC 59.966 55.000 0.00 0.0 0.00 4.85
1298 2173 9.883142 CCAAGAGATAAGATCTTCTTGTTAAGT 57.117 33.333 23.74 0.0 40.38 2.24
1904 2845 4.301072 TTTCAGGTCAGACCCCAAATAG 57.699 45.455 16.72 0.0 39.75 1.73
2148 3093 6.948309 AGGGTAAGTCATGTAAAATTGCTTCT 59.052 34.615 0.00 0.0 0.00 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.