Multiple sequence alignment - TraesCS2A01G509500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G509500 chr2A 100.000 2619 0 0 1 2619 735229985 735227367 0 4837
1 TraesCS2A01G509500 chr3A 98.969 2619 25 2 1 2617 66036834 66034216 0 4686
2 TraesCS2A01G509500 chr5B 98.894 2621 27 2 1 2619 130575283 130572663 0 4678
3 TraesCS2A01G509500 chr7A 98.664 2620 34 1 1 2619 60300726 60303345 0 4643
4 TraesCS2A01G509500 chr2B 97.901 2620 51 4 1 2619 112862595 112865211 0 4530
5 TraesCS2A01G509500 chrUn 98.905 2191 22 2 1 2189 45094237 45096427 0 3912
6 TraesCS2A01G509500 chrUn 99.192 1857 14 1 1 1856 171044524 171046380 0 3345
7 TraesCS2A01G509500 chrUn 98.630 803 11 0 1815 2617 416116996 416116194 0 1423
8 TraesCS2A01G509500 chr6B 98.275 1855 30 2 3 1856 388156032 388154179 0 3247
9 TraesCS2A01G509500 chr6B 97.251 764 21 0 1855 2618 388043410 388042647 0 1295
10 TraesCS2A01G509500 chr6B 95.948 765 27 1 1855 2619 264911509 264910749 0 1238
11 TraesCS2A01G509500 chr6D 98.166 1854 32 2 3 1856 283206986 283208837 0 3234
12 TraesCS2A01G509500 chr6D 97.898 1855 38 1 3 1856 425972862 425974716 0 3208
13 TraesCS2A01G509500 chr1B 97.386 765 19 1 1855 2619 339054913 339054150 0 1301
14 TraesCS2A01G509500 chr3B 96.863 765 24 0 1855 2619 730365095 730365859 0 1280


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G509500 chr2A 735227367 735229985 2618 True 4837 4837 100.000 1 2619 1 chr2A.!!$R1 2618
1 TraesCS2A01G509500 chr3A 66034216 66036834 2618 True 4686 4686 98.969 1 2617 1 chr3A.!!$R1 2616
2 TraesCS2A01G509500 chr5B 130572663 130575283 2620 True 4678 4678 98.894 1 2619 1 chr5B.!!$R1 2618
3 TraesCS2A01G509500 chr7A 60300726 60303345 2619 False 4643 4643 98.664 1 2619 1 chr7A.!!$F1 2618
4 TraesCS2A01G509500 chr2B 112862595 112865211 2616 False 4530 4530 97.901 1 2619 1 chr2B.!!$F1 2618
5 TraesCS2A01G509500 chrUn 45094237 45096427 2190 False 3912 3912 98.905 1 2189 1 chrUn.!!$F1 2188
6 TraesCS2A01G509500 chrUn 171044524 171046380 1856 False 3345 3345 99.192 1 1856 1 chrUn.!!$F2 1855
7 TraesCS2A01G509500 chrUn 416116194 416116996 802 True 1423 1423 98.630 1815 2617 1 chrUn.!!$R1 802
8 TraesCS2A01G509500 chr6B 388154179 388156032 1853 True 3247 3247 98.275 3 1856 1 chr6B.!!$R3 1853
9 TraesCS2A01G509500 chr6B 388042647 388043410 763 True 1295 1295 97.251 1855 2618 1 chr6B.!!$R2 763
10 TraesCS2A01G509500 chr6B 264910749 264911509 760 True 1238 1238 95.948 1855 2619 1 chr6B.!!$R1 764
11 TraesCS2A01G509500 chr6D 283206986 283208837 1851 False 3234 3234 98.166 3 1856 1 chr6D.!!$F1 1853
12 TraesCS2A01G509500 chr6D 425972862 425974716 1854 False 3208 3208 97.898 3 1856 1 chr6D.!!$F2 1853
13 TraesCS2A01G509500 chr1B 339054150 339054913 763 True 1301 1301 97.386 1855 2619 1 chr1B.!!$R1 764
14 TraesCS2A01G509500 chr3B 730365095 730365859 764 False 1280 1280 96.863 1855 2619 1 chr3B.!!$F1 764

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
891 892 0.16923 GCACGAGAGAGAAAGAGCGA 59.831 55.0 0.0 0.0 0.0 4.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2142 2145 4.753217 TGGAGTCTATAGGGGAAGATTCCG 60.753 50.0 5.55 0.0 46.37 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
891 892 0.169230 GCACGAGAGAGAAAGAGCGA 59.831 55.000 0.00 0.00 0.00 4.93
1315 1317 6.671614 TCAAATAAGTCGTGTTTTCTGTGT 57.328 33.333 0.00 0.00 0.00 3.72
1706 1709 6.985188 ATGTAAGTTCAGCGATGTACAAAT 57.015 33.333 12.97 1.52 0.00 2.32
1958 1961 1.298638 CACATCATCTCGAGCGCGA 60.299 57.895 12.10 13.08 45.71 5.87
2142 2145 2.931246 CAAAGCAATTGGGGTTGGC 58.069 52.632 7.72 0.00 35.27 4.52
2456 2459 5.846645 CGTAGACGGCGTTAAAAAGTAAAT 58.153 37.500 16.19 0.00 35.37 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
891 892 5.652452 GGTACTGCATTTCCTTAGTTGGATT 59.348 40.000 0.00 0.0 35.83 3.01
1240 1242 7.186570 AGTAGGATTTTTGGCAAGCAATAAT 57.813 32.000 0.00 0.0 0.00 1.28
1315 1317 4.645588 ACGGAAGTTGTAACATGGGAAAAA 59.354 37.500 0.00 0.0 46.40 1.94
1706 1709 7.114095 AGGTGCGGAAGTAAAATAAATCCTTA 58.886 34.615 0.00 0.0 0.00 2.69
2142 2145 4.753217 TGGAGTCTATAGGGGAAGATTCCG 60.753 50.000 5.55 0.0 46.37 4.30
2176 2179 6.126449 GGAGAAGGATTTAGGGAAAGGTACAT 60.126 42.308 0.00 0.0 0.00 2.29
2456 2459 9.216117 GATCAAACCTACTTTGCTTTAAGTCTA 57.784 33.333 3.31 0.0 39.43 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.