Multiple sequence alignment - TraesCS2A01G509400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G509400 chr2A 100.000 2408 0 0 1 2408 735223472 735225879 0 4447
1 TraesCS2A01G509400 chrUn 98.757 2414 23 2 1 2408 45100792 45098380 0 4285
2 TraesCS2A01G509400 chrUn 98.551 2416 26 4 1 2408 261513064 261515478 0 4259
3 TraesCS2A01G509400 chrUn 98.221 2417 28 6 1 2408 186163779 186161369 0 4211
4 TraesCS2A01G509400 chr5B 98.592 2415 26 3 1 2408 130614901 130612488 0 4265
5 TraesCS2A01G509400 chr5B 98.510 2416 26 5 1 2408 130609877 130607464 0 4253
6 TraesCS2A01G509400 chr5B 98.263 2418 32 3 1 2408 130568755 130571172 0 4224
7 TraesCS2A01G509400 chr3A 98.592 2414 28 1 1 2408 66030313 66032726 0 4265
8 TraesCS2A01G509400 chr2B 98.302 2414 34 2 1 2408 112869113 112866701 0 4224
9 TraesCS2A01G509400 chr5A 97.808 2418 42 4 1 2408 238861455 238859039 0 4161


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G509400 chr2A 735223472 735225879 2407 False 4447 4447 100.000 1 2408 1 chr2A.!!$F1 2407
1 TraesCS2A01G509400 chrUn 45098380 45100792 2412 True 4285 4285 98.757 1 2408 1 chrUn.!!$R1 2407
2 TraesCS2A01G509400 chrUn 261513064 261515478 2414 False 4259 4259 98.551 1 2408 1 chrUn.!!$F1 2407
3 TraesCS2A01G509400 chrUn 186161369 186163779 2410 True 4211 4211 98.221 1 2408 1 chrUn.!!$R2 2407
4 TraesCS2A01G509400 chr5B 130607464 130614901 7437 True 4259 4265 98.551 1 2408 2 chr5B.!!$R1 2407
5 TraesCS2A01G509400 chr5B 130568755 130571172 2417 False 4224 4224 98.263 1 2408 1 chr5B.!!$F1 2407
6 TraesCS2A01G509400 chr3A 66030313 66032726 2413 False 4265 4265 98.592 1 2408 1 chr3A.!!$F1 2407
7 TraesCS2A01G509400 chr2B 112866701 112869113 2412 True 4224 4224 98.302 1 2408 1 chr2B.!!$R1 2407
8 TraesCS2A01G509400 chr5A 238859039 238861455 2416 True 4161 4161 97.808 1 2408 1 chr5A.!!$R1 2407

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
972 973 0.032952 TTTGCGTGAACTAGCGGACT 59.967 50.0 0.0 0.0 35.87 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1973 7002 5.670818 TGAGTAGGATAAGGAGGAGTAGTCA 59.329 44.0 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 1.180029 GAGTCGGTAGTTGGGCACTA 58.820 55.000 0.00 0.00 36.88 2.74
395 396 1.217942 GGGCTATGGGGAAAGTGGATT 59.782 52.381 0.00 0.00 0.00 3.01
419 420 6.953101 TGATTGCCCTAGAATTACAACTACA 58.047 36.000 0.00 0.00 0.00 2.74
658 659 3.521126 AGCCGGGATCATTAAGAGCATAT 59.479 43.478 2.18 0.00 33.23 1.78
751 752 1.280710 ACATCGAAATGGTACCAGCCA 59.719 47.619 21.41 1.33 43.48 4.75
972 973 0.032952 TTTGCGTGAACTAGCGGACT 59.967 50.000 0.00 0.00 35.87 3.85
1171 1172 3.123621 GCCCTTTCGCATTATCATCTACG 59.876 47.826 0.00 0.00 0.00 3.51
1377 6405 1.009060 TGCCTGGTGATCCCTAGGTTA 59.991 52.381 9.29 0.00 35.25 2.85
1434 6462 1.749634 CTGTTTCTAGGACCGACCGAT 59.250 52.381 0.00 0.00 44.74 4.18
1641 6669 1.490910 GCATTAGGTTAGGGAGCTGGT 59.509 52.381 0.00 0.00 37.30 4.00
1935 6964 3.388350 AGCCTAGGTGTTATTACTGAGCC 59.612 47.826 11.31 0.00 0.00 4.70
1973 7002 7.831955 TCTCTAATTCCCTTCTAAGATCCTCT 58.168 38.462 0.00 0.00 0.00 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 2.501261 GACACCTACCACTTTTCACCC 58.499 52.381 0.00 0.00 0.00 4.61
395 396 6.953101 TGTAGTTGTAATTCTAGGGCAATCA 58.047 36.000 0.00 0.00 0.00 2.57
658 659 3.695830 AATTCCACTTCCTACTCGCAA 57.304 42.857 0.00 0.00 0.00 4.85
1171 1172 1.378646 CGGGAGGAAAGAAAGGGCC 60.379 63.158 0.00 0.00 0.00 5.80
1377 6405 2.074230 TTAACGACCGGACGTGCTGT 62.074 55.000 31.17 18.36 45.83 4.40
1415 6443 1.475280 CATCGGTCGGTCCTAGAAACA 59.525 52.381 0.00 0.00 0.00 2.83
1434 6462 2.674033 GTGCATGCAGGTGAGGCA 60.674 61.111 23.41 0.00 46.66 4.75
1641 6669 1.905637 TGCGGAGGAGCTATTATCGA 58.094 50.000 0.00 0.00 38.13 3.59
1795 6823 9.408648 GTTTCCCCAGAGATCTTTATCATTAAA 57.591 33.333 0.00 0.00 34.28 1.52
1973 7002 5.670818 TGAGTAGGATAAGGAGGAGTAGTCA 59.329 44.000 0.00 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.