Multiple sequence alignment - TraesCS2A01G509200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G509200 chr2A 100.000 2318 0 0 1 2318 735192656 735194973 0 4281
1 TraesCS2A01G509200 chr2A 98.793 2319 27 1 1 2318 618279955 618277637 0 4126
2 TraesCS2A01G509200 chr5A 98.836 2319 26 1 1 2318 300072980 300075298 0 4132
3 TraesCS2A01G509200 chr5A 98.404 2318 34 2 1 2318 16602918 16600604 0 4072
4 TraesCS2A01G509200 chrUn 98.663 2319 30 1 1 2318 189392540 189394858 0 4109
5 TraesCS2A01G509200 chr6A 98.619 2318 31 1 1 2318 289128633 289130949 0 4102
6 TraesCS2A01G509200 chr7B 98.578 2320 30 3 1 2318 743086200 743088518 0 4098
7 TraesCS2A01G509200 chr7D 98.404 2319 36 1 1 2318 626698489 626696171 0 4076
8 TraesCS2A01G509200 chr7D 98.275 2319 38 2 1 2318 203556344 203554027 0 4060
9 TraesCS2A01G509200 chr3B 98.318 2319 35 4 1 2318 92199605 92201920 0 4063


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G509200 chr2A 735192656 735194973 2317 False 4281 4281 100.000 1 2318 1 chr2A.!!$F1 2317
1 TraesCS2A01G509200 chr2A 618277637 618279955 2318 True 4126 4126 98.793 1 2318 1 chr2A.!!$R1 2317
2 TraesCS2A01G509200 chr5A 300072980 300075298 2318 False 4132 4132 98.836 1 2318 1 chr5A.!!$F1 2317
3 TraesCS2A01G509200 chr5A 16600604 16602918 2314 True 4072 4072 98.404 1 2318 1 chr5A.!!$R1 2317
4 TraesCS2A01G509200 chrUn 189392540 189394858 2318 False 4109 4109 98.663 1 2318 1 chrUn.!!$F1 2317
5 TraesCS2A01G509200 chr6A 289128633 289130949 2316 False 4102 4102 98.619 1 2318 1 chr6A.!!$F1 2317
6 TraesCS2A01G509200 chr7B 743086200 743088518 2318 False 4098 4098 98.578 1 2318 1 chr7B.!!$F1 2317
7 TraesCS2A01G509200 chr7D 626696171 626698489 2318 True 4076 4076 98.404 1 2318 1 chr7D.!!$R2 2317
8 TraesCS2A01G509200 chr7D 203554027 203556344 2317 True 4060 4060 98.275 1 2318 1 chr7D.!!$R1 2317
9 TraesCS2A01G509200 chr3B 92199605 92201920 2315 False 4063 4063 98.318 1 2318 1 chr3B.!!$F1 2317

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
589 591 2.417379 CGATCGTCTGTGATCCAAACCT 60.417 50.0 7.03 0.0 41.39 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1792 1798 0.472471 ACAGAGGAAACCGAAGCCAA 59.528 50.0 0.0 0.0 0.0 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 206 4.160626 GCAGACTCTACTGGTGGTATTTCT 59.839 45.833 0.00 0.00 38.22 2.52
316 317 9.314321 CAATTCTTATACGACATTAGTGGAAGT 57.686 33.333 0.00 0.00 0.00 3.01
404 405 8.522830 CAACTTAAGGAATCTTTAGATTTGGCA 58.477 33.333 7.53 0.00 44.14 4.92
589 591 2.417379 CGATCGTCTGTGATCCAAACCT 60.417 50.000 7.03 0.00 41.39 3.50
727 729 4.571919 TCTCGGGTGAATACGTGAAAAAT 58.428 39.130 0.00 0.00 30.88 1.82
838 840 7.445121 CAAGGGCTGAGATAGATATACAAACA 58.555 38.462 0.00 0.00 0.00 2.83
915 918 5.185056 TCGACTCACATTTTGATCTCCTACA 59.815 40.000 0.00 0.00 32.17 2.74
947 950 4.492232 CCCCCTACAAGTAGCCCA 57.508 61.111 1.69 0.00 31.95 5.36
1200 1206 7.333528 AGATTCAGAGCGGATCTATCTAATC 57.666 40.000 6.73 8.48 33.40 1.75
1524 1530 4.473520 ACCCGCCCGCTCTCAATG 62.474 66.667 0.00 0.00 0.00 2.82
1550 1556 4.321899 GCAAGTGACTCTCTCTCACAAGAT 60.322 45.833 1.67 0.00 40.56 2.40
1792 1798 7.928873 TGTAAGATAGAAAGAATGGGGAGTTT 58.071 34.615 0.00 0.00 0.00 2.66
1793 1799 8.390921 TGTAAGATAGAAAGAATGGGGAGTTTT 58.609 33.333 0.00 0.00 0.00 2.43
1942 1948 0.394192 TCAGGTCAGAGCTTGTGGTG 59.606 55.000 0.00 0.00 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 206 0.673985 CATATTGACCCTCGCCTCGA 59.326 55.000 0.00 0.0 0.00 4.04
316 317 5.411053 TGACAATGAATGCTACGAATGTTCA 59.589 36.000 0.00 0.0 33.82 3.18
404 405 3.107601 TGTGCCCTTTGAGTCTATAGCT 58.892 45.455 0.00 0.0 0.00 3.32
727 729 4.022935 CCATTTCACTGAGCTAAGCAACAA 60.023 41.667 0.00 0.0 0.00 2.83
838 840 5.885465 AGGGTTCTGATGTGAATTCTTCTT 58.115 37.500 7.05 0.0 0.00 2.52
938 941 4.228210 TCCTTCATTGATTCTGGGCTACTT 59.772 41.667 0.00 0.0 0.00 2.24
941 944 3.782523 ACTCCTTCATTGATTCTGGGCTA 59.217 43.478 0.00 0.0 0.00 3.93
1179 1185 4.142578 GCGATTAGATAGATCCGCTCTGAA 60.143 45.833 0.00 0.0 35.28 3.02
1390 1396 4.210120 CGCTATGCTCCTATTCACTTTCAC 59.790 45.833 0.00 0.0 0.00 3.18
1524 1530 1.271934 TGAGAGAGAGTCACTTGCTGC 59.728 52.381 0.00 0.0 0.00 5.25
1550 1556 7.597288 TGGATGAATCGGTAATCTTTCTCTA 57.403 36.000 0.00 0.0 0.00 2.43
1792 1798 0.472471 ACAGAGGAAACCGAAGCCAA 59.528 50.000 0.00 0.0 0.00 4.52
1793 1799 1.275291 CTACAGAGGAAACCGAAGCCA 59.725 52.381 0.00 0.0 0.00 4.75
1899 1905 4.157849 TGTTGTACTTGATTCACCCACA 57.842 40.909 0.00 0.0 0.00 4.17
1942 1948 1.808133 CGTAGCAGAGCCCAATCTTCC 60.808 57.143 0.00 0.0 0.00 3.46
2243 2249 2.747446 TGCTCTCGCCTTTTTGTAATCC 59.253 45.455 0.00 0.0 34.43 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.