Multiple sequence alignment - TraesCS2A01G508600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G508600 chr2A 100.000 3398 0 0 1 3398 734935648 734932251 0 6276
1 TraesCS2A01G508600 chr2A 97.557 2824 62 4 579 3398 2768049 2765229 0 4826
2 TraesCS2A01G508600 chr2A 97.755 579 11 2 1 578 174869535 174870112 0 996
3 TraesCS2A01G508600 chr5A 98.620 2826 33 2 579 3398 44279440 44276615 0 4998
4 TraesCS2A01G508600 chr7A 98.584 2824 33 3 579 3396 13133456 13130634 0 4987
5 TraesCS2A01G508600 chr7A 98.337 2826 41 2 579 3398 707670450 707673275 0 4953
6 TraesCS2A01G508600 chr7A 98.273 579 9 1 1 578 4496266 4495688 0 1013
7 TraesCS2A01G508600 chr7A 98.100 579 10 1 1 578 732847823 732848401 0 1007
8 TraesCS2A01G508600 chrUn 98.479 2827 36 3 579 3398 8808795 8805969 0 4975
9 TraesCS2A01G508600 chr7B 98.301 2826 39 5 579 3398 714452956 714450134 0 4944
10 TraesCS2A01G508600 chr3B 98.199 2831 39 3 574 3398 60270836 60273660 0 4935
11 TraesCS2A01G508600 chr3B 97.927 579 10 2 1 578 172697593 172697016 0 1002
12 TraesCS2A01G508600 chr3B 97.755 579 11 2 1 578 744588749 744588172 0 996
13 TraesCS2A01G508600 chr6B 97.910 2823 53 3 579 3398 704743237 704746056 0 4881
14 TraesCS2A01G508600 chr6B 96.344 465 11 2 2940 3398 449459809 449459345 0 760
15 TraesCS2A01G508600 chr4B 97.590 2821 41 5 578 3398 621762623 621759830 0 4807
16 TraesCS2A01G508600 chr4B 98.100 579 8 3 1 578 626420051 626419475 0 1005
17 TraesCS2A01G508600 chr6A 97.766 582 11 2 1 580 122685254 122684673 0 1002
18 TraesCS2A01G508600 chr1B 97.927 579 11 1 1 578 147137353 147137931 0 1002
19 TraesCS2A01G508600 chr3A 97.755 579 12 1 1 578 40346706 40347284 0 996


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G508600 chr2A 734932251 734935648 3397 True 6276 6276 100.000 1 3398 1 chr2A.!!$R2 3397
1 TraesCS2A01G508600 chr2A 2765229 2768049 2820 True 4826 4826 97.557 579 3398 1 chr2A.!!$R1 2819
2 TraesCS2A01G508600 chr2A 174869535 174870112 577 False 996 996 97.755 1 578 1 chr2A.!!$F1 577
3 TraesCS2A01G508600 chr5A 44276615 44279440 2825 True 4998 4998 98.620 579 3398 1 chr5A.!!$R1 2819
4 TraesCS2A01G508600 chr7A 13130634 13133456 2822 True 4987 4987 98.584 579 3396 1 chr7A.!!$R2 2817
5 TraesCS2A01G508600 chr7A 707670450 707673275 2825 False 4953 4953 98.337 579 3398 1 chr7A.!!$F1 2819
6 TraesCS2A01G508600 chr7A 4495688 4496266 578 True 1013 1013 98.273 1 578 1 chr7A.!!$R1 577
7 TraesCS2A01G508600 chr7A 732847823 732848401 578 False 1007 1007 98.100 1 578 1 chr7A.!!$F2 577
8 TraesCS2A01G508600 chrUn 8805969 8808795 2826 True 4975 4975 98.479 579 3398 1 chrUn.!!$R1 2819
9 TraesCS2A01G508600 chr7B 714450134 714452956 2822 True 4944 4944 98.301 579 3398 1 chr7B.!!$R1 2819
10 TraesCS2A01G508600 chr3B 60270836 60273660 2824 False 4935 4935 98.199 574 3398 1 chr3B.!!$F1 2824
11 TraesCS2A01G508600 chr3B 172697016 172697593 577 True 1002 1002 97.927 1 578 1 chr3B.!!$R1 577
12 TraesCS2A01G508600 chr3B 744588172 744588749 577 True 996 996 97.755 1 578 1 chr3B.!!$R2 577
13 TraesCS2A01G508600 chr6B 704743237 704746056 2819 False 4881 4881 97.910 579 3398 1 chr6B.!!$F1 2819
14 TraesCS2A01G508600 chr4B 621759830 621762623 2793 True 4807 4807 97.590 578 3398 1 chr4B.!!$R1 2820
15 TraesCS2A01G508600 chr4B 626419475 626420051 576 True 1005 1005 98.100 1 578 1 chr4B.!!$R2 577
16 TraesCS2A01G508600 chr6A 122684673 122685254 581 True 1002 1002 97.766 1 580 1 chr6A.!!$R1 579
17 TraesCS2A01G508600 chr1B 147137353 147137931 578 False 1002 1002 97.927 1 578 1 chr1B.!!$F1 577
18 TraesCS2A01G508600 chr3A 40346706 40347284 578 False 996 996 97.755 1 578 1 chr3A.!!$F1 577

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
26 27 0.879090 CACAGCATGCACACACTCAT 59.121 50.0 21.98 0.0 42.53 2.90 F
1964 1968 0.607489 CAGAACTTGGGCAGGGTGAG 60.607 60.0 0.00 0.0 0.00 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1983 1987 1.144913 TGTAGCTTGGCCACCTCTTTT 59.855 47.619 3.88 0.0 0.0 2.27 R
3031 3036 1.221840 GGCGGTGAGGATGATGTGT 59.778 57.895 0.00 0.0 0.0 3.72 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 0.879090 CACAGCATGCACACACTCAT 59.121 50.000 21.98 0.00 42.53 2.90
443 445 3.059386 GAAATTCGGCGGGTGGCA 61.059 61.111 7.21 0.00 46.16 4.92
716 720 2.125512 AAATCGCTCGCTTCGCCT 60.126 55.556 0.00 0.00 0.00 5.52
879 883 0.972471 TCAGCCGCTCATTCTCCTCA 60.972 55.000 0.00 0.00 0.00 3.86
1126 1130 6.661805 GGTTAGGGTTAGTTCATCCAAATTGA 59.338 38.462 0.00 0.00 0.00 2.57
1527 1531 6.284459 ACACCTACAAGCAGATATCTTTAGC 58.716 40.000 1.33 3.87 0.00 3.09
1612 1616 9.538508 GAAAAAGAACAGAGTAGGTGTTAACTA 57.461 33.333 7.22 0.00 38.26 2.24
1964 1968 0.607489 CAGAACTTGGGCAGGGTGAG 60.607 60.000 0.00 0.00 0.00 3.51
1983 1987 2.622942 GAGTGACAAACAAGCCCATGAA 59.377 45.455 0.00 0.00 0.00 2.57
3163 3168 3.148279 GTCGAGGACGGGAGCCAT 61.148 66.667 0.00 0.00 40.21 4.40
3271 3276 1.162181 TCGTCAGTGGACTCGTCGTT 61.162 55.000 0.00 0.00 42.05 3.85
3369 3380 4.116328 CAGCGAGGACGGCTTCGA 62.116 66.667 28.51 0.00 45.33 3.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 6.418057 TGTGTGTGTATGATATAGATGGCA 57.582 37.500 0.00 0.00 0.00 4.92
398 400 2.433664 AGCCCGTTAACTTCGCCG 60.434 61.111 3.71 0.00 0.00 6.46
530 533 2.408738 CGTCGTCGCACGTTATTTTCAA 60.409 45.455 8.22 0.00 43.14 2.69
599 602 1.532007 GTCACGTTTCCGGCAAATGTA 59.468 47.619 17.98 8.88 41.53 2.29
716 720 1.669760 CAGAAACGGGGTTAGCGCA 60.670 57.895 11.47 0.00 0.00 6.09
814 818 3.231736 AGGTGCCGTTCCGACAGT 61.232 61.111 0.00 0.00 0.00 3.55
879 883 1.444119 GAGTGAGAGCGAGCGAGGAT 61.444 60.000 0.00 0.00 0.00 3.24
1032 1036 4.097551 TGAAACCATGTTGATGTCCTCA 57.902 40.909 0.00 0.00 0.00 3.86
1964 1968 3.451141 TTTCATGGGCTTGTTTGTCAC 57.549 42.857 0.00 0.00 0.00 3.67
1983 1987 1.144913 TGTAGCTTGGCCACCTCTTTT 59.855 47.619 3.88 0.00 0.00 2.27
2108 2112 4.025040 AGTTCATTGATTGCCTGACTGA 57.975 40.909 0.00 0.00 0.00 3.41
3031 3036 1.221840 GGCGGTGAGGATGATGTGT 59.778 57.895 0.00 0.00 0.00 3.72
3271 3276 1.282447 ACTCTGAGGGCGAGTCTTCTA 59.718 52.381 9.85 0.00 37.13 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.