Multiple sequence alignment - TraesCS2A01G505700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G505700 chr2A 100.000 2583 0 0 1 2583 733862177 733864759 0.000000e+00 4771.0
1 TraesCS2A01G505700 chr5A 98.878 2050 15 2 539 2583 528603097 528605143 0.000000e+00 3651.0
2 TraesCS2A01G505700 chr5A 90.787 890 59 8 1629 2508 679148571 679147695 0.000000e+00 1168.0
3 TraesCS2A01G505700 chr5A 95.262 591 25 3 30 618 528602549 528603138 0.000000e+00 933.0
4 TraesCS2A01G505700 chr5A 84.906 318 17 2 1359 1645 679148900 679148583 2.510000e-75 292.0
5 TraesCS2A01G505700 chr1B 98.829 2050 16 2 539 2583 19024579 19026625 0.000000e+00 3646.0
6 TraesCS2A01G505700 chr1B 95.748 588 22 3 33 618 19024034 19024620 0.000000e+00 944.0
7 TraesCS2A01G505700 chr2B 98.537 2050 21 3 539 2583 335385985 335383940 0.000000e+00 3611.0
8 TraesCS2A01G505700 chr2B 95.897 585 20 4 36 618 335386526 335385944 0.000000e+00 944.0
9 TraesCS2A01G505700 chr2B 80.932 236 42 3 36 268 359878533 359878298 1.580000e-42 183.0
10 TraesCS2A01G505700 chr2B 97.059 34 1 0 1 34 730307762 730307795 9.980000e-05 58.4
11 TraesCS2A01G505700 chr4B 91.620 1062 47 18 1356 2384 640579648 640578596 0.000000e+00 1430.0
12 TraesCS2A01G505700 chr4B 94.017 819 39 6 539 1354 220282521 220281710 0.000000e+00 1232.0
13 TraesCS2A01G505700 chr4B 82.818 582 83 13 37 608 220283063 220282489 2.970000e-139 505.0
14 TraesCS2A01G505700 chr4B 90.794 315 21 3 2176 2488 640578588 640578280 5.140000e-112 414.0
15 TraesCS2A01G505700 chr6B 95.604 819 30 3 539 1354 132052345 132051530 0.000000e+00 1308.0
16 TraesCS2A01G505700 chr6B 82.824 850 100 27 36 845 624702259 624701416 0.000000e+00 719.0
17 TraesCS2A01G505700 chr6B 88.075 587 64 6 36 618 132052888 132052304 0.000000e+00 691.0
18 TraesCS2A01G505700 chr6B 94.235 451 20 3 906 1354 624701130 624700684 0.000000e+00 684.0
19 TraesCS2A01G505700 chr6B 88.624 378 36 5 224 599 176248347 176247975 1.090000e-123 453.0
20 TraesCS2A01G505700 chr6B 100.000 31 0 0 36 66 513649523 513649493 9.980000e-05 58.4
21 TraesCS2A01G505700 chr7B 95.092 815 33 5 541 1354 198976887 198977695 0.000000e+00 1277.0
22 TraesCS2A01G505700 chr7B 82.483 588 91 12 27 608 198976336 198976917 2.970000e-139 505.0
23 TraesCS2A01G505700 chr5B 93.607 438 25 2 919 1355 475689738 475690173 0.000000e+00 651.0
24 TraesCS2A01G505700 chr5B 85.465 344 24 8 469 796 475687602 475687935 4.120000e-88 335.0
25 TraesCS2A01G505700 chr5B 82.243 214 37 1 36 248 65069103 65069316 1.580000e-42 183.0
26 TraesCS2A01G505700 chr4D 87.992 483 22 12 1356 1807 498613465 498612988 2.920000e-149 538.0
27 TraesCS2A01G505700 chr4D 89.328 253 25 1 2018 2268 498612608 498612356 1.490000e-82 316.0
28 TraesCS2A01G505700 chr4D 90.308 227 14 2 2270 2488 498612191 498611965 9.040000e-75 291.0
29 TraesCS2A01G505700 chr2D 90.836 371 33 1 977 1346 461537602 461537972 1.790000e-136 496.0
30 TraesCS2A01G505700 chrUn 82.463 536 84 9 38 569 87856683 87856154 6.510000e-126 460.0
31 TraesCS2A01G505700 chrUn 88.360 378 37 5 224 599 78309109 78309481 5.070000e-122 448.0
32 TraesCS2A01G505700 chr5D 84.638 345 24 11 469 796 395261238 395261570 1.490000e-82 316.0
33 TraesCS2A01G505700 chr4A 84.783 276 41 1 36 310 737379821 737379546 2.530000e-70 276.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G505700 chr2A 733862177 733864759 2582 False 4771.000000 4771 100.000000 1 2583 1 chr2A.!!$F1 2582
1 TraesCS2A01G505700 chr5A 528602549 528605143 2594 False 2292.000000 3651 97.070000 30 2583 2 chr5A.!!$F1 2553
2 TraesCS2A01G505700 chr5A 679147695 679148900 1205 True 730.000000 1168 87.846500 1359 2508 2 chr5A.!!$R1 1149
3 TraesCS2A01G505700 chr1B 19024034 19026625 2591 False 2295.000000 3646 97.288500 33 2583 2 chr1B.!!$F1 2550
4 TraesCS2A01G505700 chr2B 335383940 335386526 2586 True 2277.500000 3611 97.217000 36 2583 2 chr2B.!!$R2 2547
5 TraesCS2A01G505700 chr4B 640578280 640579648 1368 True 922.000000 1430 91.207000 1356 2488 2 chr4B.!!$R2 1132
6 TraesCS2A01G505700 chr4B 220281710 220283063 1353 True 868.500000 1232 88.417500 37 1354 2 chr4B.!!$R1 1317
7 TraesCS2A01G505700 chr6B 132051530 132052888 1358 True 999.500000 1308 91.839500 36 1354 2 chr6B.!!$R3 1318
8 TraesCS2A01G505700 chr6B 624700684 624702259 1575 True 701.500000 719 88.529500 36 1354 2 chr6B.!!$R4 1318
9 TraesCS2A01G505700 chr7B 198976336 198977695 1359 False 891.000000 1277 88.787500 27 1354 2 chr7B.!!$F1 1327
10 TraesCS2A01G505700 chr5B 475687602 475690173 2571 False 493.000000 651 89.536000 469 1355 2 chr5B.!!$F2 886
11 TraesCS2A01G505700 chr4D 498611965 498613465 1500 True 381.666667 538 89.209333 1356 2488 3 chr4D.!!$R1 1132
12 TraesCS2A01G505700 chrUn 87856154 87856683 529 True 460.000000 460 82.463000 38 569 1 chrUn.!!$R1 531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
20 21 0.109039 GAGAAGAGAGTGGGCGTCAC 60.109 60.0 0.0 0.0 46.39 3.67 F
526 535 1.268283 AAGCAGTCAGACCTAGCCCC 61.268 60.0 0.0 0.0 0.00 5.80 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1189 2970 0.620556 ACCAGTCCGCCATTGAGAAT 59.379 50.0 0.0 0.0 0.00 2.40 R
2390 4795 0.808755 CCCGGTTGATTAGCACCAAC 59.191 55.0 0.0 0.0 41.24 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 4.854587 AGAGAAGAGAGTGGGCGT 57.145 55.556 0.00 0.00 0.00 5.68
18 19 2.573920 AGAGAAGAGAGTGGGCGTC 58.426 57.895 0.00 0.00 0.00 5.19
19 20 0.251386 AGAGAAGAGAGTGGGCGTCA 60.251 55.000 0.00 0.00 0.00 4.35
20 21 0.109039 GAGAAGAGAGTGGGCGTCAC 60.109 60.000 0.00 0.00 46.39 3.67
140 143 2.004733 GGCGGCGTAACAGTAATTTCT 58.995 47.619 9.37 0.00 0.00 2.52
526 535 1.268283 AAGCAGTCAGACCTAGCCCC 61.268 60.000 0.00 0.00 0.00 5.80
527 536 3.082579 GCAGTCAGACCTAGCCCCG 62.083 68.421 0.00 0.00 0.00 5.73
1107 2887 3.068732 GCTCTTGCTTTTCCTTTGGTCTT 59.931 43.478 0.00 0.00 36.03 3.01
1189 2970 1.117749 ATCCGCTGGCTGAGCTCATA 61.118 55.000 18.63 6.09 46.64 2.15
1257 3038 0.665369 GGTTGTGCAGTTGCTGATGC 60.665 55.000 5.62 1.33 42.66 3.91
1465 3247 3.380004 TCGATGGTTTTGCAGTTCAAGTT 59.620 39.130 0.00 0.00 35.84 2.66
2390 4795 7.542130 GTGCAGGAACCTCAAATTATGTAAAAG 59.458 37.037 0.00 0.00 0.00 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.251386 TGACGCCCACTCTCTTCTCT 60.251 55.000 0.00 0.00 0.00 3.10
1 2 0.109039 GTGACGCCCACTCTCTTCTC 60.109 60.000 1.75 0.00 42.44 2.87
2 3 1.867919 CGTGACGCCCACTCTCTTCT 61.868 60.000 0.00 0.00 43.53 2.85
3 4 1.444553 CGTGACGCCCACTCTCTTC 60.445 63.158 0.00 0.00 43.53 2.87
4 5 2.201022 ACGTGACGCCCACTCTCTT 61.201 57.895 4.25 0.00 43.53 2.85
5 6 2.597805 ACGTGACGCCCACTCTCT 60.598 61.111 4.25 0.00 43.53 3.10
6 7 2.430921 CACGTGACGCCCACTCTC 60.431 66.667 10.90 0.00 43.53 3.20
7 8 3.991051 CCACGTGACGCCCACTCT 61.991 66.667 19.30 0.00 43.53 3.24
25 26 2.536761 TATATGTTAGGTGGGCACGC 57.463 50.000 0.00 0.00 0.00 5.34
29 30 4.261614 GCAGCTTTTATATGTTAGGTGGGC 60.262 45.833 0.00 0.00 36.80 5.36
31 32 7.217200 TCTAGCAGCTTTTATATGTTAGGTGG 58.783 38.462 0.00 0.00 36.80 4.61
34 35 9.413048 GTACTCTAGCAGCTTTTATATGTTAGG 57.587 37.037 0.00 0.00 31.11 2.69
140 143 0.608035 GGATTTTCACCAGGGCGACA 60.608 55.000 0.00 0.00 0.00 4.35
196 199 0.890996 CCCACTTGTCAACTGCTCCC 60.891 60.000 0.00 0.00 0.00 4.30
1107 2887 3.482436 GGAACACACCCATCTACAACAA 58.518 45.455 0.00 0.00 0.00 2.83
1189 2970 0.620556 ACCAGTCCGCCATTGAGAAT 59.379 50.000 0.00 0.00 0.00 2.40
1257 3038 4.742201 CCACGGACGCCTCCTGTG 62.742 72.222 14.81 14.81 39.16 3.66
1465 3247 1.899437 CGCCCAGGAGAAGTTGCCTA 61.899 60.000 0.00 0.00 32.03 3.93
2390 4795 0.808755 CCCGGTTGATTAGCACCAAC 59.191 55.000 0.00 0.00 41.24 3.77


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.