Multiple sequence alignment - TraesCS2A01G493300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G493300 chr2A 100.000 2789 0 0 1 2789 725597204 725594416 0.000000e+00 5151.0
1 TraesCS2A01G493300 chr2A 99.250 2799 9 3 1 2789 725543633 725540837 0.000000e+00 5042.0
2 TraesCS2A01G493300 chr2A 99.071 2799 14 3 1 2789 725662523 725659727 0.000000e+00 5014.0
3 TraesCS2A01G493300 chr2D 90.915 1464 80 21 141 1572 590730999 590729557 0.000000e+00 1917.0
4 TraesCS2A01G493300 chr2D 84.324 740 63 23 1608 2305 590729553 590728825 0.000000e+00 675.0
5 TraesCS2A01G493300 chr2D 87.786 131 9 6 1871 1997 590725827 590725700 2.240000e-31 147.0
6 TraesCS2A01G493300 chr2D 89.041 73 4 2 2721 2789 590721474 590721402 1.380000e-13 87.9
7 TraesCS2A01G493300 chr2B 93.882 899 50 4 678 1572 716125890 716124993 0.000000e+00 1351.0
8 TraesCS2A01G493300 chr2B 85.268 1249 97 27 1608 2789 716124989 716123761 0.000000e+00 1206.0
9 TraesCS2A01G493300 chr2B 92.060 466 24 9 166 620 716126354 716125891 0.000000e+00 643.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G493300 chr2A 725594416 725597204 2788 True 5151.000000 5151 100.000000 1 2789 1 chr2A.!!$R2 2788
1 TraesCS2A01G493300 chr2A 725540837 725543633 2796 True 5042.000000 5042 99.250000 1 2789 1 chr2A.!!$R1 2788
2 TraesCS2A01G493300 chr2A 725659727 725662523 2796 True 5014.000000 5014 99.071000 1 2789 1 chr2A.!!$R3 2788
3 TraesCS2A01G493300 chr2D 590725700 590730999 5299 True 913.000000 1917 87.675000 141 2305 3 chr2D.!!$R2 2164
4 TraesCS2A01G493300 chr2B 716123761 716126354 2593 True 1066.666667 1351 90.403333 166 2789 3 chr2B.!!$R1 2623

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
633 653 0.716591 ACATGGGTCCCCTCTAGTGA 59.283 55.0 5.13 0.0 36.94 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2368 2592 6.535508 GCTTTCATGAGTACGTAATTTCCTCT 59.464 38.462 0.0 0.0 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 8.986477 ATTTCAATTAATTTCTCCCGTTGAAG 57.014 30.769 0.00 0.0 36.05 3.02
239 243 2.774687 ACACGCGGATAAGAAAACCTT 58.225 42.857 12.47 0.0 38.87 3.50
631 651 3.726837 AATACATGGGTCCCCTCTAGT 57.273 47.619 5.13 0.0 36.94 2.57
633 653 0.716591 ACATGGGTCCCCTCTAGTGA 59.283 55.000 5.13 0.0 36.94 3.41
2729 4474 8.652290 ACTATTAGTCTTTGTCTTTCCAAGTCT 58.348 33.333 0.00 0.0 0.00 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 9.476202 AAAATACAAGAATACAAAAAGCAGGAC 57.524 29.630 0.00 0.0 0.00 3.85
239 243 3.157252 GGCCGCTCATCCTCTCCA 61.157 66.667 0.00 0.0 0.00 3.86
631 651 6.763715 AGCCCAGGTGTTTATATAGAATCA 57.236 37.500 0.00 0.0 0.00 2.57
633 653 7.582719 TGAAAGCCCAGGTGTTTATATAGAAT 58.417 34.615 0.00 0.0 0.00 2.40
2368 2592 6.535508 GCTTTCATGAGTACGTAATTTCCTCT 59.464 38.462 0.00 0.0 0.00 3.69
2729 4474 7.628366 GCCTTTCATGACGGAAGAAATTGAATA 60.628 37.037 13.17 0.0 31.58 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.