Multiple sequence alignment - TraesCS2A01G486700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G486700 chr2A 100.000 2409 0 0 1 2409 721732074 721734482 0.000000e+00 4449
1 TraesCS2A01G486700 chr2A 95.762 1345 51 5 1 1342 195109723 195111064 0.000000e+00 2163
2 TraesCS2A01G486700 chr2A 97.329 861 22 1 1550 2409 195111506 195112366 0.000000e+00 1461
3 TraesCS2A01G486700 chr7A 96.643 2413 50 8 1 2409 678174578 678172193 0.000000e+00 3978
4 TraesCS2A01G486700 chr5D 94.622 2436 86 17 1 2409 254536171 254533754 0.000000e+00 3731
5 TraesCS2A01G486700 chr5D 97.038 1688 38 5 724 2409 551022179 551020502 0.000000e+00 2830
6 TraesCS2A01G486700 chr5D 96.530 317 9 1 1 315 551022502 551022186 7.630000e-145 523
7 TraesCS2A01G486700 chr7D 96.228 1856 42 5 578 2409 509916242 509914391 0.000000e+00 3014
8 TraesCS2A01G486700 chr7D 94.400 500 23 3 1 498 509916738 509916242 0.000000e+00 763
9 TraesCS2A01G486700 chr7D 87.879 99 12 0 487 585 481573848 481573750 1.510000e-22 117
10 TraesCS2A01G486700 chr1B 94.749 1695 56 12 1 1668 154144853 154146541 0.000000e+00 2606
11 TraesCS2A01G486700 chr1B 97.213 861 23 1 1550 2409 154146610 154147470 0.000000e+00 1456
12 TraesCS2A01G486700 chr1B 88.235 425 30 7 2002 2409 55536878 55536457 7.740000e-135 490
13 TraesCS2A01G486700 chr1B 88.660 97 11 0 491 587 600265608 600265512 4.210000e-23 119
14 TraesCS2A01G486700 chr4D 95.465 1345 58 2 1 1342 40828432 40829776 0.000000e+00 2143
15 TraesCS2A01G486700 chr4D 96.341 902 18 2 1509 2409 40829854 40830741 0.000000e+00 1469
16 TraesCS2A01G486700 chr4D 86.351 740 90 5 593 1332 315816823 315817551 0.000000e+00 797
17 TraesCS2A01G486700 chr1A 95.471 1347 51 5 1 1342 14531708 14530367 0.000000e+00 2141
18 TraesCS2A01G486700 chr1A 97.405 1079 25 2 1334 2409 14530328 14529250 0.000000e+00 1834
19 TraesCS2A01G486700 chr1A 88.542 96 11 0 496 591 541889397 541889492 1.510000e-22 117
20 TraesCS2A01G486700 chr1D 91.629 657 46 7 1331 1984 479501988 479502638 0.000000e+00 900
21 TraesCS2A01G486700 chrUn 91.061 660 50 7 1331 1987 260016889 260016236 0.000000e+00 883
22 TraesCS2A01G486700 chrUn 100.000 233 0 0 2177 2409 480831436 480831204 4.760000e-117 431
23 TraesCS2A01G486700 chr3A 90.938 320 23 3 1 315 365957251 365956933 2.210000e-115 425
24 TraesCS2A01G486700 chr2B 85.000 260 31 6 243 498 145371646 145371901 8.540000e-65 257
25 TraesCS2A01G486700 chr5A 83.462 260 35 7 243 498 666519610 666519355 4.000000e-58 235


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G486700 chr2A 721732074 721734482 2408 False 4449.0 4449 100.0000 1 2409 1 chr2A.!!$F1 2408
1 TraesCS2A01G486700 chr2A 195109723 195112366 2643 False 1812.0 2163 96.5455 1 2409 2 chr2A.!!$F2 2408
2 TraesCS2A01G486700 chr7A 678172193 678174578 2385 True 3978.0 3978 96.6430 1 2409 1 chr7A.!!$R1 2408
3 TraesCS2A01G486700 chr5D 254533754 254536171 2417 True 3731.0 3731 94.6220 1 2409 1 chr5D.!!$R1 2408
4 TraesCS2A01G486700 chr5D 551020502 551022502 2000 True 1676.5 2830 96.7840 1 2409 2 chr5D.!!$R2 2408
5 TraesCS2A01G486700 chr7D 509914391 509916738 2347 True 1888.5 3014 95.3140 1 2409 2 chr7D.!!$R2 2408
6 TraesCS2A01G486700 chr1B 154144853 154147470 2617 False 2031.0 2606 95.9810 1 2409 2 chr1B.!!$F1 2408
7 TraesCS2A01G486700 chr4D 40828432 40830741 2309 False 1806.0 2143 95.9030 1 2409 2 chr4D.!!$F2 2408
8 TraesCS2A01G486700 chr4D 315816823 315817551 728 False 797.0 797 86.3510 593 1332 1 chr4D.!!$F1 739
9 TraesCS2A01G486700 chr1A 14529250 14531708 2458 True 1987.5 2141 96.4380 1 2409 2 chr1A.!!$R1 2408
10 TraesCS2A01G486700 chr1D 479501988 479502638 650 False 900.0 900 91.6290 1331 1984 1 chr1D.!!$F1 653
11 TraesCS2A01G486700 chrUn 260016236 260016889 653 True 883.0 883 91.0610 1331 1987 1 chrUn.!!$R1 656

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
908 1010 1.376424 CATCCTCAGCGCCACAGTT 60.376 57.895 2.29 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1927 2483 0.03467 GCAGGCACCATCTTCTCCTT 60.035 55.0 0.0 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
442 462 7.282450 GGACGAACTAATTCTTTACCATTCCAT 59.718 37.037 0.00 0.0 32.12 3.41
445 465 8.673711 CGAACTAATTCTTTACCATTCCATCAA 58.326 33.333 0.00 0.0 32.12 2.57
453 473 7.999679 TCTTTACCATTCCATCAAAGCATAAG 58.000 34.615 0.00 0.0 0.00 1.73
520 541 6.610075 ACTCCCTCCGTAAACTAATACAAA 57.390 37.500 0.00 0.0 0.00 2.83
529 550 8.768955 TCCGTAAACTAATACAAAAGCGTTTAA 58.231 29.630 0.00 0.0 31.24 1.52
655 756 8.974060 AGAAGGTTTTGTAGTACATTTCTTGA 57.026 30.769 3.28 0.0 0.00 3.02
908 1010 1.376424 CATCCTCAGCGCCACAGTT 60.376 57.895 2.29 0.0 0.00 3.16
942 1044 4.098960 TGGATATTTTAGCGAGGTCGAGTT 59.901 41.667 2.94 0.0 43.02 3.01
982 1084 2.032681 GACGGCCTTGTCCTGCTT 59.967 61.111 0.00 0.0 32.61 3.91
1187 1289 5.966684 TCCTTAATTTTCCCCACACCTTTA 58.033 37.500 0.00 0.0 0.00 1.85
1811 2367 1.207089 TGATCTAGTGGGCTCAAACCG 59.793 52.381 0.00 0.0 0.00 4.44
1911 2467 3.059352 ACAAGTGGGAGTACATGAAGC 57.941 47.619 0.00 0.0 0.00 3.86
1927 2483 7.744087 ACATGAAGCACTACATTTTAAGTCA 57.256 32.000 0.00 0.0 0.00 3.41
2086 2642 4.956075 TGTGATCATGGAGTAGTTAGCTGA 59.044 41.667 0.00 0.0 0.00 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 272 7.167302 TGTGAATCAAGCTAAAAACAACATTCG 59.833 33.333 0.00 0.00 0.00 3.34
370 390 5.460646 CGTTGCACATTTTAAGTCCTTCAT 58.539 37.500 0.00 0.00 0.00 2.57
442 462 8.965819 TGGCTATTATGTTTTCTTATGCTTTGA 58.034 29.630 0.00 0.00 0.00 2.69
445 465 8.624776 GTCTGGCTATTATGTTTTCTTATGCTT 58.375 33.333 0.00 0.00 0.00 3.91
453 473 8.462016 AGAAATGTGTCTGGCTATTATGTTTTC 58.538 33.333 0.00 0.00 0.00 2.29
608 709 9.965824 CTTCTACATTCAAAGTACCAACATTTT 57.034 29.630 0.00 0.00 0.00 1.82
655 756 9.251792 GGAAACCATAGAAATTTTGTAACGTTT 57.748 29.630 5.91 10.97 0.00 3.60
789 891 4.361971 ACGCGAGTGAGGGGGAGA 62.362 66.667 15.93 0.00 46.97 3.71
1187 1289 2.856760 TCCTAGGCTCCAGAGATTGT 57.143 50.000 2.96 0.00 0.00 2.71
1911 2467 8.833231 TCTTCTCCTTGACTTAAAATGTAGTG 57.167 34.615 0.00 0.00 0.00 2.74
1927 2483 0.034670 GCAGGCACCATCTTCTCCTT 60.035 55.000 0.00 0.00 0.00 3.36
2086 2642 4.763793 GCATTACTCCTGCCATGATAACAT 59.236 41.667 0.00 0.00 37.19 2.71
2133 2689 6.585695 ACTGTCGAGAGGTTTCATACTAAA 57.414 37.500 14.79 0.00 0.00 1.85
2135 2691 6.883217 AGTTACTGTCGAGAGGTTTCATACTA 59.117 38.462 14.79 0.00 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.