Multiple sequence alignment - TraesCS2A01G483800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G483800 chr2A 100.000 2468 0 0 1 2468 719453775 719456242 0 4558
1 TraesCS2A01G483800 chr2A 98.907 2471 23 4 1 2468 43380269 43382738 0 4410
2 TraesCS2A01G483800 chr2A 90.678 2285 128 40 222 2468 17677299 17675062 0 2961
3 TraesCS2A01G483800 chr5B 99.149 2469 19 2 1 2468 179227000 179229467 0 4442
4 TraesCS2A01G483800 chr5B 98.948 2471 23 3 1 2468 406870617 406868147 0 4416
5 TraesCS2A01G483800 chr5B 98.063 2478 34 10 1 2468 420717182 420719655 0 4298
6 TraesCS2A01G483800 chr7B 98.907 2470 23 4 1 2468 528879482 528881949 0 4409
7 TraesCS2A01G483800 chr6B 98.907 2470 24 3 1 2468 408661941 408664409 0 4409
8 TraesCS2A01G483800 chr6B 98.746 2472 26 5 1 2468 704850705 704848235 0 4388
9 TraesCS2A01G483800 chr4B 98.464 2474 31 7 1 2468 194219136 194221608 0 4351
10 TraesCS2A01G483800 chr3B 98.021 2476 37 10 1 2468 552478135 552480606 0 4290


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G483800 chr2A 719453775 719456242 2467 False 4558 4558 100.000 1 2468 1 chr2A.!!$F2 2467
1 TraesCS2A01G483800 chr2A 43380269 43382738 2469 False 4410 4410 98.907 1 2468 1 chr2A.!!$F1 2467
2 TraesCS2A01G483800 chr2A 17675062 17677299 2237 True 2961 2961 90.678 222 2468 1 chr2A.!!$R1 2246
3 TraesCS2A01G483800 chr5B 179227000 179229467 2467 False 4442 4442 99.149 1 2468 1 chr5B.!!$F1 2467
4 TraesCS2A01G483800 chr5B 406868147 406870617 2470 True 4416 4416 98.948 1 2468 1 chr5B.!!$R1 2467
5 TraesCS2A01G483800 chr5B 420717182 420719655 2473 False 4298 4298 98.063 1 2468 1 chr5B.!!$F2 2467
6 TraesCS2A01G483800 chr7B 528879482 528881949 2467 False 4409 4409 98.907 1 2468 1 chr7B.!!$F1 2467
7 TraesCS2A01G483800 chr6B 408661941 408664409 2468 False 4409 4409 98.907 1 2468 1 chr6B.!!$F1 2467
8 TraesCS2A01G483800 chr6B 704848235 704850705 2470 True 4388 4388 98.746 1 2468 1 chr6B.!!$R1 2467
9 TraesCS2A01G483800 chr4B 194219136 194221608 2472 False 4351 4351 98.464 1 2468 1 chr4B.!!$F1 2467
10 TraesCS2A01G483800 chr3B 552478135 552480606 2471 False 4290 4290 98.021 1 2468 1 chr3B.!!$F1 2467

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
564 600 9.70529 AACATAAAAAGGGACAAACATATGTTC 57.295 29.63 21.02 9.33 37.91 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1475 1514 1.06825 GCCCCTACGTCATCAGCTC 59.932 63.158 0.0 0.0 0.0 4.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
564 600 9.705290 AACATAAAAAGGGACAAACATATGTTC 57.295 29.630 21.02 9.33 37.91 3.18
1133 1172 0.316204 GTGCAAAATGCCACAGCTCT 59.684 50.000 0.00 0.00 44.23 4.09
1302 1341 0.846693 AAGAGGCTTGGTCACAACCT 59.153 50.000 0.00 0.00 46.60 3.50
1475 1514 2.609002 GCAACAAGTTTTGAAAGCCTGG 59.391 45.455 0.00 0.00 0.00 4.45
1487 1526 2.581354 GCCTGGAGCTGATGACGT 59.419 61.111 0.00 0.00 38.99 4.34
2258 2309 5.358442 ACCTGCATGTTTGTTGTGTTAGTTA 59.642 36.000 0.00 0.00 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
60 63 7.867752 TGTTTTTCACAGTATTACTTGCCTAC 58.132 34.615 0.00 0.00 0.00 3.18
564 600 1.142465 AGAATAGCAGCAGTCATGGGG 59.858 52.381 0.00 0.00 0.00 4.96
1133 1172 2.165437 GTCTCCACTGTTTTTGCCACAA 59.835 45.455 0.00 0.00 0.00 3.33
1475 1514 1.068250 GCCCCTACGTCATCAGCTC 59.932 63.158 0.00 0.00 0.00 4.09
2258 2309 6.891908 AGGCATTTTCATCCTAATGTACAAGT 59.108 34.615 0.00 0.00 34.88 3.16
2355 2409 6.319405 GTCAAACCCTTGTTACCTAAGAACAA 59.681 38.462 1.43 1.43 42.88 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.