Multiple sequence alignment - TraesCS2A01G476900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G476900 chr2A 100.000 2594 0 0 1 2594 716392837 716395430 0.000000e+00 4791
1 TraesCS2A01G476900 chr2A 98.959 2594 26 1 1 2594 716300588 716303180 0.000000e+00 4639
2 TraesCS2A01G476900 chr2A 98.844 2596 27 2 1 2594 716340354 716342948 0.000000e+00 4625
3 TraesCS2A01G476900 chr2A 99.124 2282 19 1 1 2282 716423887 716426167 0.000000e+00 4102
4 TraesCS2A01G476900 chr2A 99.304 1436 9 1 162 1597 716252206 716253640 0.000000e+00 2595
5 TraesCS2A01G476900 chr2A 98.688 991 13 0 1604 2594 716254132 716255122 0.000000e+00 1759
6 TraesCS2A01G476900 chr2A 89.066 1381 112 26 693 2060 716247793 716249147 0.000000e+00 1677
7 TraesCS2A01G476900 chr2A 95.062 324 15 1 2271 2594 716441707 716442029 2.300000e-140 508
8 TraesCS2A01G476900 chr2A 82.061 524 67 14 2046 2562 716249164 716249667 3.090000e-114 422
9 TraesCS2A01G476900 chr2A 83.761 234 24 12 402 628 716247557 716247783 2.620000e-50 209
10 TraesCS2A01G476900 chr2B 88.617 1801 151 29 578 2358 695683961 695685727 0.000000e+00 2141
11 TraesCS2A01G476900 chr2B 89.646 1439 105 23 402 1830 695731829 695733233 0.000000e+00 1792
12 TraesCS2A01G476900 chr2B 88.846 1282 92 30 563 1828 695692643 695693889 0.000000e+00 1528
13 TraesCS2A01G476900 chr2B 86.126 1456 111 37 413 1829 695688186 695689589 0.000000e+00 1485
14 TraesCS2A01G476900 chr2B 85.324 586 70 11 1994 2565 695721602 695722185 2.220000e-165 592
15 TraesCS2A01G476900 chr2B 86.166 253 27 7 148 400 403120088 403120332 1.530000e-67 267
16 TraesCS2A01G476900 chr2B 86.784 227 16 2 2343 2565 695685983 695686199 9.280000e-60 241
17 TraesCS2A01G476900 chr2D 89.633 762 57 11 492 1235 578875148 578875905 0.000000e+00 950
18 TraesCS2A01G476900 chr2D 90.672 461 31 8 1375 1830 578876215 578876668 1.030000e-168 603
19 TraesCS2A01G476900 chr2D 85.992 257 25 10 148 400 335144996 335145245 5.500000e-67 265
20 TraesCS2A01G476900 chr3D 87.795 254 27 4 148 400 30369140 30368890 7.020000e-76 294
21 TraesCS2A01G476900 chr3D 82.099 162 26 3 2085 2244 528611687 528611527 4.500000e-28 135
22 TraesCS2A01G476900 chr6D 84.942 259 34 3 148 402 368114176 368114433 9.210000e-65 257
23 TraesCS2A01G476900 chr6D 84.354 147 21 2 2099 2244 147691282 147691137 2.690000e-30 143
24 TraesCS2A01G476900 chr5D 84.884 258 33 3 148 399 113396167 113396424 3.310000e-64 255
25 TraesCS2A01G476900 chr7A 83.673 147 23 1 2099 2244 103151227 103151081 1.250000e-28 137


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G476900 chr2A 716392837 716395430 2593 False 4791.00 4791 100.00000 1 2594 1 chr2A.!!$F3 2593
1 TraesCS2A01G476900 chr2A 716300588 716303180 2592 False 4639.00 4639 98.95900 1 2594 1 chr2A.!!$F1 2593
2 TraesCS2A01G476900 chr2A 716340354 716342948 2594 False 4625.00 4625 98.84400 1 2594 1 chr2A.!!$F2 2593
3 TraesCS2A01G476900 chr2A 716423887 716426167 2280 False 4102.00 4102 99.12400 1 2282 1 chr2A.!!$F4 2281
4 TraesCS2A01G476900 chr2A 716247557 716255122 7565 False 1332.40 2595 90.57600 162 2594 5 chr2A.!!$F6 2432
5 TraesCS2A01G476900 chr2B 695731829 695733233 1404 False 1792.00 1792 89.64600 402 1830 1 chr2B.!!$F3 1428
6 TraesCS2A01G476900 chr2B 695683961 695693889 9928 False 1348.75 2141 87.59325 413 2565 4 chr2B.!!$F4 2152
7 TraesCS2A01G476900 chr2B 695721602 695722185 583 False 592.00 592 85.32400 1994 2565 1 chr2B.!!$F2 571
8 TraesCS2A01G476900 chr2D 578875148 578876668 1520 False 776.50 950 90.15250 492 1830 2 chr2D.!!$F2 1338

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
194 4683 2.719046 GCAATGTTTCGTCGGTGAAAAG 59.281 45.455 4.86 0.0 39.40 2.27 F
1003 5549 1.744741 TTGATCGCCGCAGCAATGA 60.745 52.632 0.00 0.0 39.83 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1072 5618 2.371179 CCAGAGTATGCCAGTCCATGAT 59.629 50.000 0.0 0.0 0.0 2.45 R
1872 7109 6.359617 CGTAATTCTTGTTGTGCTTTTAGGTG 59.640 38.462 0.0 0.0 0.0 4.00 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 4683 2.719046 GCAATGTTTCGTCGGTGAAAAG 59.281 45.455 4.86 0.0 39.40 2.27
673 5192 9.915629 TTTTCGTTTGGCATTACAGTATTTTAT 57.084 25.926 0.00 0.0 0.00 1.40
1003 5549 1.744741 TTGATCGCCGCAGCAATGA 60.745 52.632 0.00 0.0 39.83 2.57
1600 6836 2.668457 GACGCCTACAACTGAATCTGTG 59.332 50.000 0.00 0.0 0.00 3.66
1601 6837 2.037251 ACGCCTACAACTGAATCTGTGT 59.963 45.455 0.00 0.0 0.00 3.72
1602 6838 2.668457 CGCCTACAACTGAATCTGTGTC 59.332 50.000 0.00 0.0 0.00 3.67
1844 7081 9.686683 AAACACTCTTATATACTGCCTCAATTT 57.313 29.630 0.00 0.0 0.00 1.82
2419 10051 4.209452 AGCGAACTTACATTTGTGTGTG 57.791 40.909 0.00 0.0 33.62 3.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
194 4683 6.459435 CCAAAAATGTGACCCCAAATTTGTTC 60.459 38.462 16.73 10.29 38.83 3.18
673 5192 2.875296 CAAAGAATGTGGTCCAGGGAA 58.125 47.619 0.00 0.00 0.00 3.97
1072 5618 2.371179 CCAGAGTATGCCAGTCCATGAT 59.629 50.000 0.00 0.00 0.00 2.45
1872 7109 6.359617 CGTAATTCTTGTTGTGCTTTTAGGTG 59.640 38.462 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.