Multiple sequence alignment - TraesCS2A01G476800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G476800 chr2A 100.000 2670 0 0 1 2670 716340355 716343024 0.000000e+00 4931.0
1 TraesCS2A01G476800 chr2A 99.064 2671 21 2 1 2670 716300589 716303256 0.000000e+00 4791.0
2 TraesCS2A01G476800 chr2A 98.802 2671 29 2 1 2670 716392838 716395506 0.000000e+00 4752.0
3 TraesCS2A01G476800 chr2A 99.168 2283 15 3 1 2282 716423888 716426167 0.000000e+00 4108.0
4 TraesCS2A01G476800 chr2A 99.235 1438 8 2 160 1597 716252206 716253640 0.000000e+00 2591.0
5 TraesCS2A01G476800 chr2A 98.694 1072 14 0 1599 2670 716254127 716255198 0.000000e+00 1903.0
6 TraesCS2A01G476800 chr2A 89.275 1380 111 24 693 2060 716247793 716249147 0.000000e+00 1694.0
7 TraesCS2A01G476800 chr2A 94.985 339 16 1 2271 2609 716441707 716442044 5.060000e-147 531.0
8 TraesCS2A01G476800 chr2A 81.870 524 68 14 2046 2562 716249164 716249667 1.480000e-112 416.0
9 TraesCS2A01G476800 chr2A 83.761 234 24 12 402 628 716247557 716247783 2.690000e-50 209.0
10 TraesCS2A01G476800 chr2B 88.827 1799 151 26 578 2358 695683961 695685727 0.000000e+00 2163.0
11 TraesCS2A01G476800 chr2B 89.847 1438 104 21 402 1830 695731829 695733233 0.000000e+00 1808.0
12 TraesCS2A01G476800 chr2B 89.141 1280 92 27 563 1828 695692643 695693889 0.000000e+00 1550.0
13 TraesCS2A01G476800 chr2B 86.460 1455 108 35 413 1829 695688186 695689589 0.000000e+00 1513.0
14 TraesCS2A01G476800 chr2B 85.495 586 69 11 1994 2565 695721602 695722185 4.920000e-167 597.0
15 TraesCS2A01G476800 chr2B 84.314 255 30 7 146 400 403120088 403120332 9.550000e-60 241.0
16 TraesCS2A01G476800 chr2B 86.784 227 16 2 2343 2565 695685983 695686199 9.550000e-60 241.0
17 TraesCS2A01G476800 chr2B 94.000 50 3 0 2563 2612 695686226 695686275 2.850000e-10 76.8
18 TraesCS2A01G476800 chr2D 89.764 762 56 11 492 1235 578875148 578875905 0.000000e+00 955.0
19 TraesCS2A01G476800 chr2D 84.825 257 30 7 146 400 335144996 335145245 1.590000e-62 250.0
20 TraesCS2A01G476800 chr5B 85.547 256 25 7 146 401 661526050 661526293 9.480000e-65 257.0
21 TraesCS2A01G476800 chr4A 90.374 187 13 2 220 401 676528488 676528674 9.550000e-60 241.0
22 TraesCS2A01G476800 chr1A 83.929 224 30 5 146 369 299490094 299490311 2.690000e-50 209.0
23 TraesCS2A01G476800 chr6D 84.354 147 21 2 2099 2244 147691282 147691137 2.770000e-30 143.0
24 TraesCS2A01G476800 chr6D 81.481 162 26 4 2085 2244 65763382 65763541 2.160000e-26 130.0
25 TraesCS2A01G476800 chr3D 82.099 162 26 3 2085 2244 528611687 528611527 4.640000e-28 135.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G476800 chr2A 716340355 716343024 2669 False 4931.00 4931 100.0000 1 2670 1 chr2A.!!$F2 2669
1 TraesCS2A01G476800 chr2A 716300589 716303256 2667 False 4791.00 4791 99.0640 1 2670 1 chr2A.!!$F1 2669
2 TraesCS2A01G476800 chr2A 716392838 716395506 2668 False 4752.00 4752 98.8020 1 2670 1 chr2A.!!$F3 2669
3 TraesCS2A01G476800 chr2A 716423888 716426167 2279 False 4108.00 4108 99.1680 1 2282 1 chr2A.!!$F4 2281
4 TraesCS2A01G476800 chr2A 716247557 716255198 7641 False 1362.60 2591 90.5670 160 2670 5 chr2A.!!$F6 2510
5 TraesCS2A01G476800 chr2B 695731829 695733233 1404 False 1808.00 1808 89.8470 402 1830 1 chr2B.!!$F3 1428
6 TraesCS2A01G476800 chr2B 695683961 695693889 9928 False 1108.76 2163 89.0424 413 2612 5 chr2B.!!$F4 2199
7 TraesCS2A01G476800 chr2B 695721602 695722185 583 False 597.00 597 85.4950 1994 2565 1 chr2B.!!$F2 571
8 TraesCS2A01G476800 chr2D 578875148 578875905 757 False 955.00 955 89.7640 492 1235 1 chr2D.!!$F2 743

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
369 4861 0.705253 TTATTTTTGGGCCCGGGAGA 59.295 50.0 29.31 2.84 0.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1894 6934 0.471191 AAAACTCCCTCCGTTCCGTT 59.529 50.0 0.0 0.0 0.0 4.44 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 4720 5.990996 GTCACATTTTTGGATGACATTTGGT 59.009 36.000 0.00 0.00 40.95 3.67
268 4760 5.469760 ACATGCCAAAATGCTTAACCTTTTC 59.530 36.000 0.00 0.00 0.00 2.29
369 4861 0.705253 TTATTTTTGGGCCCGGGAGA 59.295 50.000 29.31 2.84 0.00 3.71
1587 6141 4.171103 GCCAACCCCGACGCCTAT 62.171 66.667 0.00 0.00 0.00 2.57
1894 6934 7.575414 TTGACCTAAAAGCACAACAAGAATA 57.425 32.000 0.00 0.00 0.00 1.75
1998 9357 6.803154 AACACTCTCCCGAAAATAGAAAAG 57.197 37.500 0.00 0.00 0.00 2.27
2416 9851 4.286910 TCAAAGCGAACTTACATTTGTGC 58.713 39.130 0.00 0.00 34.05 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 4760 1.667724 CTACCTGCAGATTTTGAGGCG 59.332 52.381 17.39 0.0 31.25 5.52
1164 5709 4.262894 CCTGAGGTAAAGTTGAACTGCCTA 60.263 45.833 13.73 0.0 29.77 3.93
1894 6934 0.471191 AAAACTCCCTCCGTTCCGTT 59.529 50.000 0.00 0.0 0.00 4.44
1966 9325 6.855763 TTTCGGGAGAGTGTTTAGGTATTA 57.144 37.500 0.00 0.0 41.75 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.