Multiple sequence alignment - TraesCS2A01G449300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G449300 chr2A 100.000 2948 0 0 1 2948 699129055 699132002 0 5445
1 TraesCS2A01G449300 chr2B 96.290 2965 65 23 1 2948 666934336 666937272 0 4824
2 TraesCS2A01G449300 chr2D 96.967 2209 43 10 1 2199 558481278 558483472 0 3687
3 TraesCS2A01G449300 chr2D 98.239 795 9 3 2158 2948 558483470 558484263 0 1386


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G449300 chr2A 699129055 699132002 2947 False 5445.0 5445 100.000 1 2948 1 chr2A.!!$F1 2947
1 TraesCS2A01G449300 chr2B 666934336 666937272 2936 False 4824.0 4824 96.290 1 2948 1 chr2B.!!$F1 2947
2 TraesCS2A01G449300 chr2D 558481278 558484263 2985 False 2536.5 3687 97.603 1 2948 2 chr2D.!!$F1 2947

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
653 664 0.036858 GCTTGCCGTCCTCTCTTCTT 60.037 55.000 0.00 0.0 0.00 2.52 F
1107 1118 2.046023 TACGCCAAGCAGCAGCAT 60.046 55.556 3.17 0.0 45.49 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1836 1847 0.250901 GCTGGTTGAAGAAGGGCAGA 60.251 55.000 0.0 0.0 0.0 4.26 R
2062 2073 1.136057 GTTTCCTTGGATCGTTCGTGC 60.136 52.381 0.0 0.0 0.0 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 73 2.553086 TGAACCACCAAACTCGTGTAC 58.447 47.619 0.00 0.00 0.00 2.90
157 164 2.971598 CGCTGGAAGTGGGACCCAT 61.972 63.158 18.51 0.00 41.82 4.00
159 166 2.078452 CTGGAAGTGGGACCCATGT 58.922 57.895 18.51 7.65 35.28 3.21
275 282 1.067516 CGGCATAAAGCTTCCAATGGG 59.932 52.381 0.00 0.00 44.79 4.00
558 569 1.566298 ATGTTGCACCTCCTCCTCCC 61.566 60.000 0.00 0.00 0.00 4.30
594 605 0.793617 TCTCAAACCCCCTCTCCTCT 59.206 55.000 0.00 0.00 0.00 3.69
595 606 1.199615 CTCAAACCCCCTCTCCTCTC 58.800 60.000 0.00 0.00 0.00 3.20
612 623 0.043334 CTCCTCCTCCCCCTTTCTCA 59.957 60.000 0.00 0.00 0.00 3.27
613 624 0.725133 TCCTCCTCCCCCTTTCTCAT 59.275 55.000 0.00 0.00 0.00 2.90
614 625 1.135960 CCTCCTCCCCCTTTCTCATC 58.864 60.000 0.00 0.00 0.00 2.92
615 626 1.344906 CCTCCTCCCCCTTTCTCATCT 60.345 57.143 0.00 0.00 0.00 2.90
616 627 2.090494 CCTCCTCCCCCTTTCTCATCTA 60.090 54.545 0.00 0.00 0.00 1.98
653 664 0.036858 GCTTGCCGTCCTCTCTTCTT 60.037 55.000 0.00 0.00 0.00 2.52
1107 1118 2.046023 TACGCCAAGCAGCAGCAT 60.046 55.556 3.17 0.00 45.49 3.79
1188 1199 2.355481 GAGAACAACGACGGCGGT 60.355 61.111 18.49 4.79 43.17 5.68
2059 2070 2.566913 TGCAAAAAGGTTAGAGCACGA 58.433 42.857 0.00 0.00 0.00 4.35
2062 2073 3.541711 CAAAAAGGTTAGAGCACGAACG 58.458 45.455 0.00 0.00 33.56 3.95
2589 2641 8.537858 TGAGCTAACATAATCATGCATATCTCT 58.462 33.333 0.00 0.00 35.39 3.10
2644 2696 4.142049 TGTTGGAGTTGTCAAATTGGGAAC 60.142 41.667 0.00 0.00 0.00 3.62
2782 2838 7.891561 GCTATAGTATATAGCTCATGGGGAAG 58.108 42.308 17.57 0.00 42.63 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 49 3.445805 ACACGAGTTTGGTGGTTCAAATT 59.554 39.130 0.00 0.00 38.64 1.82
96 103 4.473520 CGCGGTTGGATCTGGCCT 62.474 66.667 3.32 0.00 0.00 5.19
157 164 2.760799 ATACCGCGCCCCTACACA 60.761 61.111 0.00 0.00 0.00 3.72
159 166 2.059190 TTCATACCGCGCCCCTACA 61.059 57.895 0.00 0.00 0.00 2.74
275 282 1.021390 ACAGTGATGGCTTAGCGTGC 61.021 55.000 0.00 0.00 0.00 5.34
558 569 2.224378 TGAGAGCTTCTTCCAACCAGTG 60.224 50.000 0.00 0.00 0.00 3.66
594 605 0.725133 ATGAGAAAGGGGGAGGAGGA 59.275 55.000 0.00 0.00 0.00 3.71
595 606 1.135960 GATGAGAAAGGGGGAGGAGG 58.864 60.000 0.00 0.00 0.00 4.30
612 623 6.804083 AGCTATGAAGAGGAGGAGATTAGAT 58.196 40.000 0.00 0.00 0.00 1.98
613 624 6.212840 AGCTATGAAGAGGAGGAGATTAGA 57.787 41.667 0.00 0.00 0.00 2.10
614 625 6.690530 CAAGCTATGAAGAGGAGGAGATTAG 58.309 44.000 0.00 0.00 0.00 1.73
615 626 5.011533 GCAAGCTATGAAGAGGAGGAGATTA 59.988 44.000 0.00 0.00 0.00 1.75
616 627 4.202346 GCAAGCTATGAAGAGGAGGAGATT 60.202 45.833 0.00 0.00 0.00 2.40
1287 1298 1.168714 GCTTGGGCTTGTTCTTCGAT 58.831 50.000 0.00 0.00 35.22 3.59
1836 1847 0.250901 GCTGGTTGAAGAAGGGCAGA 60.251 55.000 0.00 0.00 0.00 4.26
1936 1947 4.101585 ACCTGTGAGAATTCAGAACTGTGA 59.898 41.667 8.44 0.00 32.98 3.58
2059 2070 1.289109 CCTTGGATCGTTCGTGCGTT 61.289 55.000 1.99 0.00 0.00 4.84
2062 2073 1.136057 GTTTCCTTGGATCGTTCGTGC 60.136 52.381 0.00 0.00 0.00 5.34
2589 2641 6.093495 CACAACCAGAAAAGAACTAAGTGACA 59.907 38.462 0.00 0.00 0.00 3.58
2782 2838 1.480137 ACATAGACAGACAGCTGAGGC 59.520 52.381 23.35 12.07 45.17 4.70


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.