Multiple sequence alignment - TraesCS2A01G439000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G439000 chr2A 100.000 2321 0 0 1 2321 690342163 690344483 0.000000e+00 4287.0
1 TraesCS2A01G439000 chr3A 97.889 2321 49 0 1 2321 60827770 60825450 0.000000e+00 4015.0
2 TraesCS2A01G439000 chr3A 96.488 2335 66 3 1 2321 740090434 740088102 0.000000e+00 3843.0
3 TraesCS2A01G439000 chr3A 94.591 2348 99 11 1 2321 328922642 328924988 0.000000e+00 3607.0
4 TraesCS2A01G439000 chr7A 97.761 2322 48 2 1 2321 665977650 665979968 0.000000e+00 3997.0
5 TraesCS2A01G439000 chr7A 97.047 2337 53 2 1 2321 94445682 94443346 0.000000e+00 3919.0
6 TraesCS2A01G439000 chr5A 97.045 2335 54 2 1 2321 30143729 30146062 0.000000e+00 3916.0
7 TraesCS2A01G439000 chr5A 96.053 1140 31 1 1 1126 375869504 375868365 0.000000e+00 1844.0
8 TraesCS2A01G439000 chr5A 94.687 847 31 1 1 833 27595303 27596149 0.000000e+00 1303.0
9 TraesCS2A01G439000 chr2D 96.645 2295 69 2 34 2321 63681737 63684030 0.000000e+00 3805.0
10 TraesCS2A01G439000 chr7D 96.397 2276 74 2 53 2321 463977644 463979918 0.000000e+00 3742.0
11 TraesCS2A01G439000 chr7D 94.102 763 19 2 1 749 501826069 501825319 0.000000e+00 1136.0
12 TraesCS2A01G439000 chr4D 96.527 2217 69 2 112 2321 496006351 496008566 0.000000e+00 3661.0
13 TraesCS2A01G439000 chr1A 95.455 2288 100 2 34 2321 72584857 72587140 0.000000e+00 3646.0
14 TraesCS2A01G439000 chr1B 94.057 2322 114 9 1 2300 122762301 122764620 0.000000e+00 3502.0
15 TraesCS2A01G439000 chr3D 95.767 874 23 1 1 860 448310866 448309993 0.000000e+00 1397.0
16 TraesCS2A01G439000 chr6A 85.859 99 0 1 1 85 36427328 36427230 2.460000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G439000 chr2A 690342163 690344483 2320 False 4287 4287 100.000 1 2321 1 chr2A.!!$F1 2320
1 TraesCS2A01G439000 chr3A 60825450 60827770 2320 True 4015 4015 97.889 1 2321 1 chr3A.!!$R1 2320
2 TraesCS2A01G439000 chr3A 740088102 740090434 2332 True 3843 3843 96.488 1 2321 1 chr3A.!!$R2 2320
3 TraesCS2A01G439000 chr3A 328922642 328924988 2346 False 3607 3607 94.591 1 2321 1 chr3A.!!$F1 2320
4 TraesCS2A01G439000 chr7A 665977650 665979968 2318 False 3997 3997 97.761 1 2321 1 chr7A.!!$F1 2320
5 TraesCS2A01G439000 chr7A 94443346 94445682 2336 True 3919 3919 97.047 1 2321 1 chr7A.!!$R1 2320
6 TraesCS2A01G439000 chr5A 30143729 30146062 2333 False 3916 3916 97.045 1 2321 1 chr5A.!!$F2 2320
7 TraesCS2A01G439000 chr5A 375868365 375869504 1139 True 1844 1844 96.053 1 1126 1 chr5A.!!$R1 1125
8 TraesCS2A01G439000 chr5A 27595303 27596149 846 False 1303 1303 94.687 1 833 1 chr5A.!!$F1 832
9 TraesCS2A01G439000 chr2D 63681737 63684030 2293 False 3805 3805 96.645 34 2321 1 chr2D.!!$F1 2287
10 TraesCS2A01G439000 chr7D 463977644 463979918 2274 False 3742 3742 96.397 53 2321 1 chr7D.!!$F1 2268
11 TraesCS2A01G439000 chr7D 501825319 501826069 750 True 1136 1136 94.102 1 749 1 chr7D.!!$R1 748
12 TraesCS2A01G439000 chr4D 496006351 496008566 2215 False 3661 3661 96.527 112 2321 1 chr4D.!!$F1 2209
13 TraesCS2A01G439000 chr1A 72584857 72587140 2283 False 3646 3646 95.455 34 2321 1 chr1A.!!$F1 2287
14 TraesCS2A01G439000 chr1B 122762301 122764620 2319 False 3502 3502 94.057 1 2300 1 chr1B.!!$F1 2299
15 TraesCS2A01G439000 chr3D 448309993 448310866 873 True 1397 1397 95.767 1 860 1 chr3D.!!$R1 859

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
150 171 3.410631 TTTGTAGGATGTTTGAGCCGA 57.589 42.857 0.0 0.0 34.13 5.54 F
1012 1038 3.319405 CGGAGCATGTATGAGGAGTAAGT 59.681 47.826 0.0 0.0 0.00 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1075 1101 0.623723 ATGGTGAAGTTACGGCCCAT 59.376 50.000 0.00 0.0 0.0 4.00 R
1884 1914 1.699634 GAGGGCCATAATCTAGGTGCA 59.300 52.381 6.18 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 51 7.206687 TGAAAAGAATTGGTGTTGGTAATGTC 58.793 34.615 0.00 0.0 0.00 3.06
150 171 3.410631 TTTGTAGGATGTTTGAGCCGA 57.589 42.857 0.00 0.0 34.13 5.54
387 413 7.438459 GCTACGAGCCTTATTTTAGAAGAATGA 59.562 37.037 0.00 0.0 34.48 2.57
1012 1038 3.319405 CGGAGCATGTATGAGGAGTAAGT 59.681 47.826 0.00 0.0 0.00 2.24
1111 1137 1.373570 CATTGCTCCGGAAGAACCTC 58.626 55.000 5.23 0.0 36.31 3.85
1462 1492 2.228822 GGCATCTTCCACATCGTGTTTT 59.771 45.455 0.00 0.0 0.00 2.43
1805 1835 2.062636 TCCTTAAGGGTGCTTGGACTT 58.937 47.619 21.53 0.0 36.25 3.01
1851 1881 1.002868 GTGAGGCTGCTGATGGTGT 60.003 57.895 0.00 0.0 0.00 4.16
2285 2330 1.444553 CTGTCTTCCGCTCGTCCAC 60.445 63.158 0.00 0.0 0.00 4.02
2300 2345 1.377725 CCACCTTCGAGCCAAGCAT 60.378 57.895 0.00 0.0 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 51 9.892130 AGAACTACTACAAATTATCCCAAAGAG 57.108 33.333 0.00 0.0 0.00 2.85
387 413 4.090761 TGAGCACAAACTGGAGAAGATT 57.909 40.909 0.00 0.0 0.00 2.40
460 486 3.307906 CCGGTCTCCAACGGTCCA 61.308 66.667 0.00 0.0 44.85 4.02
589 615 1.002134 CTTTGTCGCCACCCCTCAT 60.002 57.895 0.00 0.0 0.00 2.90
893 919 8.836413 CAAATTATCATTACCTGACGGTACAAT 58.164 33.333 0.00 0.0 45.29 2.71
1012 1038 3.485463 ACCACCAAGACAAGATTTCGA 57.515 42.857 0.00 0.0 0.00 3.71
1075 1101 0.623723 ATGGTGAAGTTACGGCCCAT 59.376 50.000 0.00 0.0 0.00 4.00
1111 1137 2.325082 CGTCAAAAGGCCACTCCCG 61.325 63.158 5.01 0.0 34.51 5.14
1462 1492 5.587289 GTTGTTGTACTCCAAATTGCTTCA 58.413 37.500 0.00 0.0 34.07 3.02
1851 1881 7.622081 TGGTCTCCCTAATAGAGTTGTTGAATA 59.378 37.037 0.00 0.0 32.93 1.75
1884 1914 1.699634 GAGGGCCATAATCTAGGTGCA 59.300 52.381 6.18 0.0 0.00 4.57
2285 2330 2.796651 GCATGCTTGGCTCGAAGG 59.203 61.111 11.37 0.0 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.