Multiple sequence alignment - TraesCS2A01G435700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G435700 chr2A 100.000 2816 0 0 1 2816 688227014 688229829 0.000000e+00 5201.0
1 TraesCS2A01G435700 chr2A 97.350 2830 57 9 1 2816 688216317 688219142 0.000000e+00 4795.0
2 TraesCS2A01G435700 chr2A 97.337 2779 65 3 45 2816 688205626 688208402 0.000000e+00 4713.0
3 TraesCS2A01G435700 chr2D 86.566 2047 186 40 804 2816 545047190 545045199 0.000000e+00 2174.0
4 TraesCS2A01G435700 chr2D 94.796 442 14 5 369 806 545047660 545047224 0.000000e+00 680.0
5 TraesCS2A01G435700 chr2B 84.997 1833 220 26 835 2628 651962064 651960248 0.000000e+00 1810.0
6 TraesCS2A01G435700 chr2B 90.257 544 48 4 2192 2732 651950740 651950199 0.000000e+00 706.0
7 TraesCS2A01G435700 chr2B 86.667 405 41 9 369 765 651962481 651962082 1.200000e-118 436.0
8 TraesCS2A01G435700 chr2B 96.386 83 3 0 2734 2816 651935402 651935320 1.360000e-28 137.0
9 TraesCS2A01G435700 chr2B 83.838 99 16 0 1506 1604 660985357 660985455 8.300000e-16 95.3
10 TraesCS2A01G435700 chr7A 92.950 383 14 4 1 377 163350894 163350519 1.910000e-151 545.0
11 TraesCS2A01G435700 chr6A 92.708 384 16 3 1 378 116953198 116952821 6.860000e-151 544.0
12 TraesCS2A01G435700 chr6A 92.267 375 16 8 1 375 601152668 601153029 1.160000e-143 520.0
13 TraesCS2A01G435700 chr6A 90.741 378 23 9 1 372 548785441 548785070 7.010000e-136 494.0
14 TraesCS2A01G435700 chr5A 91.990 387 13 7 1 381 440954426 440954800 6.910000e-146 527.0
15 TraesCS2A01G435700 chr3A 91.731 387 20 4 1 379 63035466 63035084 6.910000e-146 527.0
16 TraesCS2A01G435700 chr3A 91.117 394 25 3 1 388 82893493 82893104 2.480000e-145 525.0
17 TraesCS2A01G435700 chr6D 78.750 160 33 1 1445 1603 13856171 13856012 3.840000e-19 106.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G435700 chr2A 688227014 688229829 2815 False 5201 5201 100.000 1 2816 1 chr2A.!!$F3 2815
1 TraesCS2A01G435700 chr2A 688216317 688219142 2825 False 4795 4795 97.350 1 2816 1 chr2A.!!$F2 2815
2 TraesCS2A01G435700 chr2A 688205626 688208402 2776 False 4713 4713 97.337 45 2816 1 chr2A.!!$F1 2771
3 TraesCS2A01G435700 chr2D 545045199 545047660 2461 True 1427 2174 90.681 369 2816 2 chr2D.!!$R1 2447
4 TraesCS2A01G435700 chr2B 651960248 651962481 2233 True 1123 1810 85.832 369 2628 2 chr2B.!!$R3 2259
5 TraesCS2A01G435700 chr2B 651950199 651950740 541 True 706 706 90.257 2192 2732 1 chr2B.!!$R2 540

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
365 375 0.038067 TAGTTTAGCGCGGCTGTTGA 60.038 50.0 8.83 0.0 40.1 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2290 2402 2.666317 TCAGAGGTAGATGCGAATGGA 58.334 47.619 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
248 258 1.984321 AAGTGTTTTCAACCGCGCGT 61.984 50.000 29.95 14.24 0.00 6.01
365 375 0.038067 TAGTTTAGCGCGGCTGTTGA 60.038 50.000 8.83 0.00 40.10 3.18
723 733 6.492772 AGGAGAAAATTCTTGAACTGAATGCT 59.507 34.615 0.00 0.00 37.73 3.79
772 782 4.293634 TCCTTCTCATTTTTATCCCCCACA 59.706 41.667 0.00 0.00 0.00 4.17
779 789 7.291182 TCTCATTTTTATCCCCCACAAAAGAAA 59.709 33.333 0.00 0.00 0.00 2.52
1000 1052 2.104792 GCCAGTGATGATACTAAGCCCA 59.895 50.000 0.00 0.00 0.00 5.36
1334 1386 3.181451 ACCTTCAGATGCTTCAAGTGTCA 60.181 43.478 2.07 0.00 0.00 3.58
2214 2326 0.324645 ATGAGGATGCAACCCCAACC 60.325 55.000 9.78 0.00 0.00 3.77
2290 2402 3.485711 CGCTACGATGCAACATCACATTT 60.486 43.478 8.21 0.00 0.00 2.32
2368 2481 1.377987 GCCGCACCATTGGTAAGGA 60.378 57.895 24.76 0.00 34.70 3.36
2479 2592 0.332293 ATGCCACCATCCACATCACA 59.668 50.000 0.00 0.00 0.00 3.58
2599 2714 0.460109 CCACGATCGCTCATCACCAA 60.460 55.000 16.60 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
248 258 1.227031 CGCGCTATAACGGGTTGGA 60.227 57.895 5.56 0.00 40.69 3.53
595 605 3.687698 TCATCAGTGACGATGTACTTCGA 59.312 43.478 30.79 12.19 42.82 3.71
1068 1120 4.541714 AGAAGATCAAGAAAATCCCCTCCA 59.458 41.667 0.00 0.00 0.00 3.86
1334 1386 4.578871 TGTGTATGCAGCTTCAACTACAT 58.421 39.130 3.65 0.00 0.00 2.29
1681 1742 5.266733 ACGGTACAGAAACTGAAACAGTA 57.733 39.130 0.00 0.00 44.62 2.74
2154 2225 4.281435 TCACGGTAACCTAGTTGATTGACA 59.719 41.667 0.00 0.00 0.00 3.58
2214 2326 7.921214 TCTTTTCTTCAACTATCTATACTGGCG 59.079 37.037 0.00 0.00 0.00 5.69
2290 2402 2.666317 TCAGAGGTAGATGCGAATGGA 58.334 47.619 0.00 0.00 0.00 3.41
2368 2481 4.379243 CGTGGGTGAGCCGCTCTT 62.379 66.667 20.87 0.00 34.97 2.85
2479 2592 2.287308 GCTAGCATCTTCGACGTGATCT 60.287 50.000 10.63 3.65 0.00 2.75
2599 2714 2.221169 ACAGTGACAACGATGCAATGT 58.779 42.857 13.94 13.94 37.20 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.