Multiple sequence alignment - TraesCS2A01G429300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G429300 chr2A 100.000 2549 0 0 1 2549 682509705 682507157 0.000000e+00 4708.0
1 TraesCS2A01G429300 chr2A 99.246 663 5 0 1 663 682500737 682501399 0.000000e+00 1197.0
2 TraesCS2A01G429300 chr2A 100.000 572 0 0 1 572 682514022 682514593 0.000000e+00 1057.0
3 TraesCS2A01G429300 chr2B 99.043 1985 19 0 565 2549 776222954 776224938 0.000000e+00 3561.0
4 TraesCS2A01G429300 chr2B 99.042 1983 17 2 568 2549 776449264 776447283 0.000000e+00 3555.0
5 TraesCS2A01G429300 chr2B 99.040 1980 19 0 570 2549 781094238 781096217 0.000000e+00 3552.0
6 TraesCS2A01G429300 chr2B 91.892 333 21 2 210 536 643099054 643099386 6.430000e-126 460.0
7 TraesCS2A01G429300 chr2B 88.506 174 11 5 42 207 643098830 643099002 4.300000e-48 202.0
8 TraesCS2A01G429300 chr4B 98.990 1981 18 2 570 2549 368430370 368428391 0.000000e+00 3546.0
9 TraesCS2A01G429300 chr6A 98.941 1983 19 2 568 2549 616131291 616133272 0.000000e+00 3544.0
10 TraesCS2A01G429300 chr3A 98.941 1983 19 2 568 2549 54951912 54953893 0.000000e+00 3544.0
11 TraesCS2A01G429300 chr7A 98.989 1978 20 0 572 2549 39015367 39017344 0.000000e+00 3542.0
12 TraesCS2A01G429300 chr3B 98.989 1979 19 1 571 2549 702857656 702855679 0.000000e+00 3542.0
13 TraesCS2A01G429300 chr7B 98.940 1982 18 2 568 2549 202776911 202778889 0.000000e+00 3541.0
14 TraesCS2A01G429300 chr2D 91.732 508 28 7 42 536 539232334 539232840 0.000000e+00 693.0
15 TraesCS2A01G429300 chrUn 100.000 339 0 0 1 339 431971647 431971309 5.990000e-176 627.0
16 TraesCS2A01G429300 chr5B 100.000 33 0 0 3 35 115366671 115366639 7.610000e-06 62.1
17 TraesCS2A01G429300 chr5A 91.111 45 2 2 2 45 667223182 667223225 2.740000e-05 60.2
18 TraesCS2A01G429300 chr6D 92.683 41 1 2 3 43 109270220 109270258 9.850000e-05 58.4
19 TraesCS2A01G429300 chr6D 90.698 43 3 1 3 44 363382168 363382210 3.540000e-04 56.5
20 TraesCS2A01G429300 chr4D 92.683 41 2 1 3 43 399424432 399424471 9.850000e-05 58.4
21 TraesCS2A01G429300 chr4A 90.698 43 3 1 3 44 469105117 469105159 3.540000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G429300 chr2A 682507157 682509705 2548 True 4708 4708 100.000 1 2549 1 chr2A.!!$R1 2548
1 TraesCS2A01G429300 chr2A 682500737 682501399 662 False 1197 1197 99.246 1 663 1 chr2A.!!$F1 662
2 TraesCS2A01G429300 chr2A 682514022 682514593 571 False 1057 1057 100.000 1 572 1 chr2A.!!$F2 571
3 TraesCS2A01G429300 chr2B 776222954 776224938 1984 False 3561 3561 99.043 565 2549 1 chr2B.!!$F1 1984
4 TraesCS2A01G429300 chr2B 776447283 776449264 1981 True 3555 3555 99.042 568 2549 1 chr2B.!!$R1 1981
5 TraesCS2A01G429300 chr2B 781094238 781096217 1979 False 3552 3552 99.040 570 2549 1 chr2B.!!$F2 1979
6 TraesCS2A01G429300 chr2B 643098830 643099386 556 False 331 460 90.199 42 536 2 chr2B.!!$F3 494
7 TraesCS2A01G429300 chr4B 368428391 368430370 1979 True 3546 3546 98.990 570 2549 1 chr4B.!!$R1 1979
8 TraesCS2A01G429300 chr6A 616131291 616133272 1981 False 3544 3544 98.941 568 2549 1 chr6A.!!$F1 1981
9 TraesCS2A01G429300 chr3A 54951912 54953893 1981 False 3544 3544 98.941 568 2549 1 chr3A.!!$F1 1981
10 TraesCS2A01G429300 chr7A 39015367 39017344 1977 False 3542 3542 98.989 572 2549 1 chr7A.!!$F1 1977
11 TraesCS2A01G429300 chr3B 702855679 702857656 1977 True 3542 3542 98.989 571 2549 1 chr3B.!!$R1 1978
12 TraesCS2A01G429300 chr7B 202776911 202778889 1978 False 3541 3541 98.940 568 2549 1 chr7B.!!$F1 1981
13 TraesCS2A01G429300 chr2D 539232334 539232840 506 False 693 693 91.732 42 536 1 chr2D.!!$F1 494

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
934 996 0.978146 GGAAGCTAGCTGTGGAGGGA 60.978 60.0 20.16 0.0 0.0 4.2 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2303 2509 1.195448 GCAACATTCACGGTCTCACTG 59.805 52.381 0.0 0.0 0.0 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
748 810 2.044946 GGACCAGGCGGCAGAAAT 60.045 61.111 13.08 0.0 34.57 2.17
934 996 0.978146 GGAAGCTAGCTGTGGAGGGA 60.978 60.000 20.16 0.0 0.00 4.20
1014 1076 1.558756 AGCTCCATGTCTTCCTCAAGG 59.441 52.381 0.00 0.0 0.00 3.61
1239 1301 6.349611 GGTTGATCTGTTTAGTGTTCATGCAT 60.350 38.462 0.00 0.0 0.00 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
768 830 3.286751 ACAAGCCACGCGTGCAAT 61.287 55.556 33.17 17.72 41.4 3.56
1239 1301 3.318839 CCCAAAGAAAGAAGCATGTCACA 59.681 43.478 0.00 0.00 0.0 3.58
1635 1837 6.625873 AAATGTTGGTCACTTCTTCTCTTC 57.374 37.500 0.00 0.00 0.0 2.87
2303 2509 1.195448 GCAACATTCACGGTCTCACTG 59.805 52.381 0.00 0.00 0.0 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.