Multiple sequence alignment - TraesCS2A01G383800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G383800 chr2A 100.000 2882 0 0 1 2882 628647575 628644694 0.000000e+00 5323
1 TraesCS2A01G383800 chr2A 98.820 2882 33 1 1 2882 628570444 628573324 0.000000e+00 5132
2 TraesCS2A01G383800 chr2A 98.751 2883 32 3 1 2882 374484314 374487193 0.000000e+00 5121
3 TraesCS2A01G383800 chr2A 98.127 2883 46 4 1 2882 161527509 161530384 0.000000e+00 5018
4 TraesCS2A01G383800 chr2A 94.915 354 18 0 1 354 313891390 313891743 3.240000e-154 555
5 TraesCS2A01G383800 chr1A 98.578 2884 39 2 1 2882 409609871 409612754 0.000000e+00 5097
6 TraesCS2A01G383800 chr1B 97.953 2882 55 2 1 2882 95492680 95495557 0.000000e+00 4992
7 TraesCS2A01G383800 chr1B 97.918 2882 57 2 2 2882 530763484 530760605 0.000000e+00 4987
8 TraesCS2A01G383800 chr1B 96.407 167 6 0 2716 2882 95497196 95497362 2.830000e-70 276
9 TraesCS2A01G383800 chr2B 97.503 2884 66 3 1 2882 424684378 424681499 0.000000e+00 4922
10 TraesCS2A01G383800 chr7D 97.163 2890 68 5 1 2882 474677585 474680468 0.000000e+00 4870
11 TraesCS2A01G383800 chr6A 98.147 2159 39 1 725 2882 610981356 610983514 0.000000e+00 3764


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G383800 chr2A 628644694 628647575 2881 True 5323 5323 100.000 1 2882 1 chr2A.!!$R1 2881
1 TraesCS2A01G383800 chr2A 628570444 628573324 2880 False 5132 5132 98.820 1 2882 1 chr2A.!!$F4 2881
2 TraesCS2A01G383800 chr2A 374484314 374487193 2879 False 5121 5121 98.751 1 2882 1 chr2A.!!$F3 2881
3 TraesCS2A01G383800 chr2A 161527509 161530384 2875 False 5018 5018 98.127 1 2882 1 chr2A.!!$F1 2881
4 TraesCS2A01G383800 chr1A 409609871 409612754 2883 False 5097 5097 98.578 1 2882 1 chr1A.!!$F1 2881
5 TraesCS2A01G383800 chr1B 530760605 530763484 2879 True 4987 4987 97.918 2 2882 1 chr1B.!!$R1 2880
6 TraesCS2A01G383800 chr1B 95492680 95497362 4682 False 2634 4992 97.180 1 2882 2 chr1B.!!$F1 2881
7 TraesCS2A01G383800 chr2B 424681499 424684378 2879 True 4922 4922 97.503 1 2882 1 chr2B.!!$R1 2881
8 TraesCS2A01G383800 chr7D 474677585 474680468 2883 False 4870 4870 97.163 1 2882 1 chr7D.!!$F1 2881
9 TraesCS2A01G383800 chr6A 610981356 610983514 2158 False 3764 3764 98.147 725 2882 1 chr6A.!!$F1 2157

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
678 682 1.693799 AAGAGGAGGAGAGGGTCTCT 58.306 55.0 4.02 0.0 44.28 3.10 F
1711 1718 2.505819 GAGAGGAATAAGCCAAGGGTCA 59.494 50.0 0.00 0.0 0.00 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1791 1802 1.103803 CGGGGATCTTGAAGACTCGA 58.896 55.000 0.0 0.0 0.0 4.04 R
2829 4658 1.643292 CAGTATGCAATCCACGCCG 59.357 57.895 0.0 0.0 0.0 6.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
109 110 3.446442 ACCATCTGAAGGAGTTTGCAT 57.554 42.857 5.85 0.0 0.00 3.96
593 597 2.262915 CTGCTCGAGGGTCACCAC 59.737 66.667 15.58 0.0 40.13 4.16
678 682 1.693799 AAGAGGAGGAGAGGGTCTCT 58.306 55.000 4.02 0.0 44.28 3.10
715 719 6.100668 ACTAGCCGTGACTTTATTTCTCTTC 58.899 40.000 0.00 0.0 0.00 2.87
1025 1029 8.585471 ATGATCAAAGAGATAAGGAAGCAAAA 57.415 30.769 0.00 0.0 37.00 2.44
1458 1462 4.834496 TGGCAAGAATCAAGGAGAAACATT 59.166 37.500 0.00 0.0 0.00 2.71
1711 1718 2.505819 GAGAGGAATAAGCCAAGGGTCA 59.494 50.000 0.00 0.0 0.00 4.02
1791 1802 6.141560 CTTGAAGAAGAAGTCAAGGCTTTT 57.858 37.500 0.00 0.0 44.59 2.27
2203 2219 3.879295 TCTAAACTGCTATGATGCCTTGC 59.121 43.478 0.00 0.0 0.00 4.01
2219 2236 4.841246 TGCCTTGCCCCTAGAAAATAAAAA 59.159 37.500 0.00 0.0 0.00 1.94
2829 4658 2.541762 GACTAACCGAATGCATGAGAGC 59.458 50.000 0.00 0.0 0.00 4.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
352 353 8.357290 TCAGGAAGATCAACAAAATTCATGAT 57.643 30.769 0.00 0.00 36.22 2.45
593 597 1.604604 TTTTTGAGGAGGCTCAACCG 58.395 50.000 17.69 0.00 46.52 4.44
678 682 5.870978 GTCACGGCTAGTTTATTACCTTTGA 59.129 40.000 0.00 0.00 0.00 2.69
715 719 6.033966 GGTTTTAAGCAAATAATGTCCCGAG 58.966 40.000 0.00 0.00 0.00 4.63
1025 1029 2.740826 CGTCCCATGAAACGCCGT 60.741 61.111 6.85 0.00 31.48 5.68
1229 1233 2.662866 ACCATCATGCAATTCTCCCAG 58.337 47.619 0.00 0.00 0.00 4.45
1458 1462 4.033009 TCCAAGATTCTCACCATCAGCTA 58.967 43.478 0.00 0.00 0.00 3.32
1578 1582 5.342017 TCTCTTCTCCATTTCTTGAGGGTA 58.658 41.667 0.00 0.00 0.00 3.69
1711 1718 7.497249 GCAGTTTTTGATAGAGTACTCATCCAT 59.503 37.037 24.44 11.53 0.00 3.41
1791 1802 1.103803 CGGGGATCTTGAAGACTCGA 58.896 55.000 0.00 0.00 0.00 4.04
2203 2219 5.899547 AGCATCCCTTTTTATTTTCTAGGGG 59.100 40.000 0.00 0.00 44.67 4.79
2219 2236 7.141758 TCTGATCTATGTTAAAAGCATCCCT 57.858 36.000 0.00 0.00 0.00 4.20
2829 4658 1.643292 CAGTATGCAATCCACGCCG 59.357 57.895 0.00 0.00 0.00 6.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.