Multiple sequence alignment - TraesCS2A01G383500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G383500 chr2A 100.000 2882 0 0 1 2882 628570444 628573325 0.000000e+00 5323
1 TraesCS2A01G383500 chr2A 98.821 2883 33 1 1 2882 628647575 628644693 0.000000e+00 5134
2 TraesCS2A01G383500 chr2A 98.613 2884 35 4 1 2882 374484314 374487194 0.000000e+00 5099
3 TraesCS2A01G383500 chr2A 98.128 2884 45 5 1 2882 161527509 161530385 0.000000e+00 5018
4 TraesCS2A01G383500 chr2A 94.034 352 21 0 1 352 313891390 313891741 4.230000e-148 534
5 TraesCS2A01G383500 chr1A 98.579 2885 38 3 1 2882 409609871 409612755 0.000000e+00 5097
6 TraesCS2A01G383500 chr1B 97.954 2883 54 3 1 2882 95492680 95495558 0.000000e+00 4992
7 TraesCS2A01G383500 chr1B 97.919 2883 56 3 2 2882 530763484 530760604 0.000000e+00 4988
8 TraesCS2A01G383500 chr1B 97.024 168 5 0 2715 2882 95497196 95497363 1.690000e-72 283
9 TraesCS2A01G383500 chr2B 97.539 2885 64 5 1 2882 424684378 424681498 0.000000e+00 4927
10 TraesCS2A01G383500 chr7D 97.164 2891 67 6 1 2882 474677585 474680469 0.000000e+00 4870
11 TraesCS2A01G383500 chr6A 98.102 2160 39 2 725 2882 610981356 610983515 0.000000e+00 3760


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G383500 chr2A 628570444 628573325 2881 False 5323.0 5323 100.000 1 2882 1 chr2A.!!$F4 2881
1 TraesCS2A01G383500 chr2A 628644693 628647575 2882 True 5134.0 5134 98.821 1 2882 1 chr2A.!!$R1 2881
2 TraesCS2A01G383500 chr2A 374484314 374487194 2880 False 5099.0 5099 98.613 1 2882 1 chr2A.!!$F3 2881
3 TraesCS2A01G383500 chr2A 161527509 161530385 2876 False 5018.0 5018 98.128 1 2882 1 chr2A.!!$F1 2881
4 TraesCS2A01G383500 chr1A 409609871 409612755 2884 False 5097.0 5097 98.579 1 2882 1 chr1A.!!$F1 2881
5 TraesCS2A01G383500 chr1B 530760604 530763484 2880 True 4988.0 4988 97.919 2 2882 1 chr1B.!!$R1 2880
6 TraesCS2A01G383500 chr1B 95492680 95497363 4683 False 2637.5 4992 97.489 1 2882 2 chr1B.!!$F1 2881
7 TraesCS2A01G383500 chr2B 424681498 424684378 2880 True 4927.0 4927 97.539 1 2882 1 chr2B.!!$R1 2881
8 TraesCS2A01G383500 chr7D 474677585 474680469 2884 False 4870.0 4870 97.164 1 2882 1 chr7D.!!$F1 2881
9 TraesCS2A01G383500 chr6A 610981356 610983515 2159 False 3760.0 3760 98.102 725 2882 1 chr6A.!!$F1 2157

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
652 656 1.661341 CATCACCTCCTACAAGCAGC 58.339 55.000 0.0 0.0 0.0 5.25 F
1223 1227 4.342378 AGACAAAAGGCTTCCCTCTTTTTC 59.658 41.667 0.0 0.0 41.9 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1677 1683 0.039764 TCCTCTCATCGTCCACCTGT 59.960 55.0 0.00 0.0 0.00 4.00 R
2689 2705 5.926542 GCAGACTGAAGTGACAATAACACTA 59.073 40.0 6.65 0.0 46.01 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 2.158623 ACCATCTGAAGGAGTTTGCACA 60.159 45.455 5.85 0.0 0.00 4.57
209 210 5.440610 GGGATTAGGAATCTTGAAGAAGCA 58.559 41.667 0.00 0.0 38.01 3.91
652 656 1.661341 CATCACCTCCTACAAGCAGC 58.339 55.000 0.00 0.0 0.00 5.25
1223 1227 4.342378 AGACAAAAGGCTTCCCTCTTTTTC 59.658 41.667 0.00 0.0 41.90 2.29
1677 1683 7.447594 AGAAGTACTTGGAAATAAGGACGAAA 58.552 34.615 14.14 0.0 44.52 3.46
1749 1755 5.963176 TCAAAAACTGCATTGATCTGCTA 57.037 34.783 8.27 0.0 42.75 3.49
2434 2450 4.697352 ACTTGGATCTATTTGTGTGTGCTC 59.303 41.667 0.00 0.0 0.00 4.26
2492 2508 7.864108 TTTGTCCATGTGATATTTGTAGAGG 57.136 36.000 0.00 0.0 0.00 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
364 365 3.981071 ATCACCGTCAGGAAGATCAAA 57.019 42.857 0.00 0.0 41.02 2.69
615 619 3.450817 TGATGCTCTATCCCTTTCGACAA 59.549 43.478 0.00 0.0 34.77 3.18
652 656 1.203523 CCTCTCCTCCTCTTTGTCACG 59.796 57.143 0.00 0.0 0.00 4.35
1223 1227 3.056393 TCATGCAATTCTCCCAAAGCTTG 60.056 43.478 0.00 0.0 0.00 4.01
1677 1683 0.039764 TCCTCTCATCGTCCACCTGT 59.960 55.000 0.00 0.0 0.00 4.00
1749 1755 6.713762 TCAAGTGTGATCTCCATTGTTTTT 57.286 33.333 0.00 0.0 0.00 1.94
2312 2328 9.574516 AATTAGTTTGAGAGTGAAATACTTGGT 57.425 29.630 0.00 0.0 40.53 3.67
2363 2379 8.306313 TGGAGCATTCTTATGTAGAACTTCTA 57.694 34.615 0.00 0.0 45.33 2.10
2366 2382 7.187824 TCTGGAGCATTCTTATGTAGAACTT 57.812 36.000 0.00 0.0 45.33 2.66
2434 2450 9.213799 GAATAGATATGAAGCCTTCCACTAAAG 57.786 37.037 1.21 0.0 0.00 1.85
2492 2508 8.762426 AGTCGTTTCAGAAATAGTGTTTAGTTC 58.238 33.333 0.00 0.0 0.00 3.01
2689 2705 5.926542 GCAGACTGAAGTGACAATAACACTA 59.073 40.000 6.65 0.0 46.01 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.