Multiple sequence alignment - TraesCS2A01G383400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G383400 chr2A 100.000 2546 0 0 1 2546 628568649 628571194 0 4702
1 TraesCS2A01G383400 chr2A 98.469 2547 34 3 1 2546 628649367 628646825 0 4482
2 TraesCS2A01G383400 chr2A 97.958 2547 48 4 1 2546 161525715 161528258 0 4412
3 TraesCS2A01G383400 chr2A 97.998 2547 42 7 1 2546 374482524 374485062 0 4412
4 TraesCS2A01G383400 chr1A 98.038 2548 46 4 1 2546 409608077 409610622 0 4425
5 TraesCS2A01G383400 chr6A 98.095 2520 44 4 1 2518 610962097 610964614 0 4385
6 TraesCS2A01G383400 chr6A 98.095 2520 44 4 1 2518 610986578 610989095 0 4385
7 TraesCS2A01G383400 chr6A 97.966 2360 41 5 164 2518 611012824 611015181 0 4085
8 TraesCS2A01G383400 chr1B 98.089 2041 35 4 507 2546 95491392 95493429 0 3550
9 TraesCS2A01G383400 chr1B 93.370 543 8 6 23 541 95490854 95491392 0 778
10 TraesCS2A01G383400 chr1B 93.574 498 8 1 68 541 530777516 530777019 0 721
11 TraesCS2A01G383400 chr2B 97.551 2042 45 4 507 2546 424685667 424683629 0 3489
12 TraesCS2A01G383400 chr2B 93.692 539 10 7 27 541 424686205 424685667 0 785
13 TraesCS2A01G383400 chr3D 94.411 984 28 7 3 960 531301427 531302409 0 1487


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G383400 chr2A 628568649 628571194 2545 False 4702 4702 100.0000 1 2546 1 chr2A.!!$F3 2545
1 TraesCS2A01G383400 chr2A 628646825 628649367 2542 True 4482 4482 98.4690 1 2546 1 chr2A.!!$R1 2545
2 TraesCS2A01G383400 chr2A 161525715 161528258 2543 False 4412 4412 97.9580 1 2546 1 chr2A.!!$F1 2545
3 TraesCS2A01G383400 chr2A 374482524 374485062 2538 False 4412 4412 97.9980 1 2546 1 chr2A.!!$F2 2545
4 TraesCS2A01G383400 chr1A 409608077 409610622 2545 False 4425 4425 98.0380 1 2546 1 chr1A.!!$F1 2545
5 TraesCS2A01G383400 chr6A 610962097 610964614 2517 False 4385 4385 98.0950 1 2518 1 chr6A.!!$F1 2517
6 TraesCS2A01G383400 chr6A 610986578 610989095 2517 False 4385 4385 98.0950 1 2518 1 chr6A.!!$F2 2517
7 TraesCS2A01G383400 chr6A 611012824 611015181 2357 False 4085 4085 97.9660 164 2518 1 chr6A.!!$F3 2354
8 TraesCS2A01G383400 chr1B 95490854 95493429 2575 False 2164 3550 95.7295 23 2546 2 chr1B.!!$F1 2523
9 TraesCS2A01G383400 chr2B 424683629 424686205 2576 True 2137 3489 95.6215 27 2546 2 chr2B.!!$R1 2519
10 TraesCS2A01G383400 chr3D 531301427 531302409 982 False 1487 1487 94.4110 3 960 1 chr3D.!!$F1 957

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
101 102 0.391597 AATGTGGTCGTCAAGGTCGT 59.608 50.0 0.00 0.0 0.0 4.34 F
1186 1278 0.606604 GGAGTTACTCGAAGGGCACA 59.393 55.0 6.27 0.0 0.0 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1471 1563 2.557056 TCTCGTGTCCGACTGAATCTTT 59.443 45.455 0.0 0.0 38.4 2.52 R
2447 2541 1.203523 CCTCTCCTCCTCTTTGTCACG 59.796 57.143 0.0 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 102 0.391597 AATGTGGTCGTCAAGGTCGT 59.608 50.000 0.00 0.0 0.00 4.34
209 210 8.584157 TCTTCCCGTTGTTAGTAATTTGTACTA 58.416 33.333 0.00 0.0 0.00 1.82
412 461 1.554617 TGCTGGCTGCTGATAGTACAA 59.445 47.619 17.45 0.0 43.37 2.41
1045 1137 1.962570 TAGGAAGGGGGAGGAGGAGC 61.963 65.000 0.00 0.0 0.00 4.70
1186 1278 0.606604 GGAGTTACTCGAAGGGCACA 59.393 55.000 6.27 0.0 0.00 4.57
1302 1394 7.171678 ACCAGAATTAAAGTCGAAGAGAAACTG 59.828 37.037 0.00 0.0 36.95 3.16
1314 1406 5.582269 CGAAGAGAAACTGGCATCATTTCTA 59.418 40.000 16.79 0.0 41.58 2.10
1435 1527 4.662179 TCATCCCTATTCTCTCCAAGCATT 59.338 41.667 0.00 0.0 0.00 3.56
1471 1563 0.994247 ATCCCAGTCAAGTGCATCCA 59.006 50.000 0.00 0.0 0.00 3.41
1754 1846 0.846427 TTGTGGCTGGGAGGGATCTT 60.846 55.000 0.00 0.0 0.00 2.40
1775 1867 5.652891 TCTTCTACCGATGCTAAAGTTCTCT 59.347 40.000 0.00 0.0 0.00 3.10
1905 1997 2.158623 ACCATCTGAAGGAGTTTGCACA 60.159 45.455 5.85 0.0 0.00 4.57
2004 2096 5.440610 GGGATTAGGAATCTTGAAGAAGCA 58.559 41.667 0.00 0.0 38.01 3.91
2447 2541 1.661341 CATCACCTCCTACAAGCAGC 58.339 55.000 0.00 0.0 0.00 5.25
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
101 102 3.680777 AGGAAACCCCAAGAAAAGTCA 57.319 42.857 0.0 0.0 37.41 3.41
209 210 5.126067 ACACAAAATTGTACTGCTGACTCT 58.874 37.500 0.0 0.0 39.91 3.24
412 461 7.054124 ACTACATTTTGGGACGAACATCATAT 58.946 34.615 0.0 0.0 0.00 1.78
757 843 9.479549 AACCAACAATACATGAATAAGGAGAAT 57.520 29.630 0.0 0.0 0.00 2.40
1045 1137 9.941991 GAAAACAAATAACATCATTTCGTCATG 57.058 29.630 0.0 0.0 0.00 3.07
1131 1223 2.738846 GCCTGTTAGCGATGATGTATGG 59.261 50.000 0.0 0.0 0.00 2.74
1186 1278 3.134574 TGCTACCCGACAGTTTTTGAT 57.865 42.857 0.0 0.0 0.00 2.57
1471 1563 2.557056 TCTCGTGTCCGACTGAATCTTT 59.443 45.455 0.0 0.0 38.40 2.52
1754 1846 4.098044 CCAGAGAACTTTAGCATCGGTAGA 59.902 45.833 0.0 0.0 0.00 2.59
2159 2251 3.981071 ATCACCGTCAGGAAGATCAAA 57.019 42.857 0.0 0.0 41.02 2.69
2410 2504 3.450817 TGATGCTCTATCCCTTTCGACAA 59.549 43.478 0.0 0.0 34.77 3.18
2447 2541 1.203523 CCTCTCCTCCTCTTTGTCACG 59.796 57.143 0.0 0.0 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.