Multiple sequence alignment - TraesCS2A01G376100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G376100 chr2A 100.000 1950 0 0 1 1950 618278460 618276511 0.000000e+00 3602
1 TraesCS2A01G376100 chr2A 100.000 673 0 0 2051 2723 618276410 618275738 0.000000e+00 1243
2 TraesCS2A01G376100 chrUn 99.590 1951 7 1 1 1950 189394035 189395985 0.000000e+00 3557
3 TraesCS2A01G376100 chrUn 99.554 673 3 0 2051 2723 40108027 40107355 0.000000e+00 1227
4 TraesCS2A01G376100 chrUn 99.406 673 4 0 2051 2723 67968488 67969160 0.000000e+00 1221
5 TraesCS2A01G376100 chr5B 99.487 1950 10 0 1 1950 679660393 679662342 0.000000e+00 3546
6 TraesCS2A01G376100 chr5B 99.257 673 5 0 2051 2723 713060046 713060718 0.000000e+00 1216
7 TraesCS2A01G376100 chr7B 99.436 1950 11 0 1 1950 743087695 743089644 0.000000e+00 3541
8 TraesCS2A01G376100 chr7B 99.703 673 2 0 2051 2723 743127169 743127841 0.000000e+00 1232
9 TraesCS2A01G376100 chr7B 99.554 673 3 0 2051 2723 743052490 743051818 0.000000e+00 1227
10 TraesCS2A01G376100 chr7B 99.406 673 4 0 2051 2723 698162342 698161670 0.000000e+00 1221
11 TraesCS2A01G376100 chr5A 99.385 1950 12 0 1 1950 16601427 16599478 0.000000e+00 3535
12 TraesCS2A01G376100 chr5A 99.385 1950 12 0 1 1950 300074475 300076424 0.000000e+00 3535
13 TraesCS2A01G376100 chr4D 99.385 1950 12 0 1 1950 123414378 123416327 0.000000e+00 3535
14 TraesCS2A01G376100 chr7D 99.385 1950 11 1 2 1950 203554849 203552900 0.000000e+00 3533
15 TraesCS2A01G376100 chr6A 99.282 1950 14 0 1 1950 289130126 289132075 0.000000e+00 3524
16 TraesCS2A01G376100 chr7A 99.079 1955 13 1 1 1950 4961333 4963287 0.000000e+00 3506
17 TraesCS2A01G376100 chr7A 99.257 673 5 0 2051 2723 671973638 671974310 0.000000e+00 1216
18 TraesCS2A01G376100 chr4A 99.554 673 3 0 2051 2723 435550813 435551485 0.000000e+00 1227
19 TraesCS2A01G376100 chr1B 99.257 673 5 0 2051 2723 583514600 583515272 0.000000e+00 1216
20 TraesCS2A01G376100 chr2D 99.245 265 1 1 1679 1943 429491575 429491838 6.820000e-131 477


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G376100 chr2A 618275738 618278460 2722 True 2422.5 3602 100.000 1 2723 2 chr2A.!!$R1 2722
1 TraesCS2A01G376100 chrUn 189394035 189395985 1950 False 3557.0 3557 99.590 1 1950 1 chrUn.!!$F2 1949
2 TraesCS2A01G376100 chrUn 40107355 40108027 672 True 1227.0 1227 99.554 2051 2723 1 chrUn.!!$R1 672
3 TraesCS2A01G376100 chrUn 67968488 67969160 672 False 1221.0 1221 99.406 2051 2723 1 chrUn.!!$F1 672
4 TraesCS2A01G376100 chr5B 679660393 679662342 1949 False 3546.0 3546 99.487 1 1950 1 chr5B.!!$F1 1949
5 TraesCS2A01G376100 chr5B 713060046 713060718 672 False 1216.0 1216 99.257 2051 2723 1 chr5B.!!$F2 672
6 TraesCS2A01G376100 chr7B 743087695 743089644 1949 False 3541.0 3541 99.436 1 1950 1 chr7B.!!$F1 1949
7 TraesCS2A01G376100 chr7B 743127169 743127841 672 False 1232.0 1232 99.703 2051 2723 1 chr7B.!!$F2 672
8 TraesCS2A01G376100 chr7B 743051818 743052490 672 True 1227.0 1227 99.554 2051 2723 1 chr7B.!!$R2 672
9 TraesCS2A01G376100 chr7B 698161670 698162342 672 True 1221.0 1221 99.406 2051 2723 1 chr7B.!!$R1 672
10 TraesCS2A01G376100 chr5A 16599478 16601427 1949 True 3535.0 3535 99.385 1 1950 1 chr5A.!!$R1 1949
11 TraesCS2A01G376100 chr5A 300074475 300076424 1949 False 3535.0 3535 99.385 1 1950 1 chr5A.!!$F1 1949
12 TraesCS2A01G376100 chr4D 123414378 123416327 1949 False 3535.0 3535 99.385 1 1950 1 chr4D.!!$F1 1949
13 TraesCS2A01G376100 chr7D 203552900 203554849 1949 True 3533.0 3533 99.385 2 1950 1 chr7D.!!$R1 1948
14 TraesCS2A01G376100 chr6A 289130126 289132075 1949 False 3524.0 3524 99.282 1 1950 1 chr6A.!!$F1 1949
15 TraesCS2A01G376100 chr7A 4961333 4963287 1954 False 3506.0 3506 99.079 1 1950 1 chr7A.!!$F1 1949
16 TraesCS2A01G376100 chr7A 671973638 671974310 672 False 1216.0 1216 99.257 2051 2723 1 chr7A.!!$F2 672
17 TraesCS2A01G376100 chr4A 435550813 435551485 672 False 1227.0 1227 99.554 2051 2723 1 chr4A.!!$F1 672
18 TraesCS2A01G376100 chr1B 583514600 583515272 672 False 1216.0 1216 99.257 2051 2723 1 chr1B.!!$F1 672

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1409 1417 9.403583 TGTATTCATCTTGTTCCTTATTTACCC 57.596 33.333 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2519 2527 6.155221 AGCTCTCAGGTTTAGTGATTCATACA 59.845 38.462 0.0 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1409 1417 9.403583 TGTATTCATCTTGTTCCTTATTTACCC 57.596 33.333 0.0 0.0 0.0 3.69
1466 1474 2.741878 CGGCTCCTATTTCAATCCGTGT 60.742 50.000 0.0 0.0 0.0 4.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
265 271 7.173907 CCATTCTTTCTATCTTACATCGCCATT 59.826 37.037 0.00 0.00 0.00 3.16
648 654 5.163055 CCTTTCAGGGGATGAGGATATTTCA 60.163 44.000 0.00 0.00 39.68 2.69
1409 1417 2.051345 GAAAACGCAGTGCACCCG 60.051 61.111 21.50 21.50 45.00 5.28
1466 1474 6.593268 TTATTGGTATATCGATCGGTCCAA 57.407 37.500 18.93 18.93 37.76 3.53
2519 2527 6.155221 AGCTCTCAGGTTTAGTGATTCATACA 59.845 38.462 0.00 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.