Multiple sequence alignment - TraesCS2A01G360100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G360100 chr2A 100.000 2636 0 0 1 2636 604496201 604493566 0.000000e+00 4868
1 TraesCS2A01G360100 chr2A 96.501 2658 71 2 1 2636 604504089 604501432 0.000000e+00 4373
2 TraesCS2A01G360100 chr2A 86.231 1300 132 35 1359 2636 454907274 454906000 0.000000e+00 1365
3 TraesCS2A01G360100 chr2A 87.830 1175 118 20 1477 2636 327302904 327304068 0.000000e+00 1354
4 TraesCS2A01G360100 chr2A 89.894 376 38 0 986 1361 454947569 454947944 3.940000e-133 484
5 TraesCS2A01G360100 chr2A 92.105 114 7 1 510 623 70085605 70085494 2.720000e-35 159
6 TraesCS2A01G360100 chr2A 92.727 110 4 4 413 521 450934114 450934220 3.510000e-34 156
7 TraesCS2A01G360100 chr2A 91.818 110 5 4 413 521 388501320 388501214 1.630000e-32 150
8 TraesCS2A01G360100 chr2A 92.523 107 4 4 416 521 388509429 388509326 1.630000e-32 150
9 TraesCS2A01G360100 chr2A 90.909 110 6 4 413 521 384098078 384097972 7.600000e-31 145
10 TraesCS2A01G360100 chr3A 93.881 2680 101 12 1 2632 271623859 271626523 0.000000e+00 3982
11 TraesCS2A01G360100 chr3A 94.148 1948 91 6 708 2636 271616666 271618609 0.000000e+00 2944
12 TraesCS2A01G360100 chr3A 88.056 427 37 13 1 421 150018960 150019378 6.550000e-136 494
13 TraesCS2A01G360100 chr3A 92.233 309 23 1 516 824 368696970 368696663 1.120000e-118 436
14 TraesCS2A01G360100 chr3A 91.262 309 26 1 516 824 699350849 699350542 1.130000e-113 420
15 TraesCS2A01G360100 chr3A 92.727 110 4 4 413 521 506491694 506491800 3.510000e-34 156
16 TraesCS2A01G360100 chr3A 90.351 114 9 2 1414 1526 578902505 578902617 5.880000e-32 148
17 TraesCS2A01G360100 chr3A 90.351 114 9 2 1414 1526 578910340 578910452 5.880000e-32 148
18 TraesCS2A01G360100 chr3A 89.565 115 10 2 1413 1526 247539124 247539011 7.600000e-31 145
19 TraesCS2A01G360100 chr3A 85.833 120 13 3 1416 1533 666981910 666982027 9.910000e-25 124
20 TraesCS2A01G360100 chr7A 90.233 1075 91 12 1570 2636 396966085 396965017 0.000000e+00 1391
21 TraesCS2A01G360100 chr7A 87.628 1172 118 24 1477 2632 298991292 298992452 0.000000e+00 1336
22 TraesCS2A01G360100 chr7A 90.514 253 24 0 1118 1370 511395878 511395626 4.200000e-88 335
23 TraesCS2A01G360100 chr7A 88.991 218 22 2 605 822 307981433 307981218 4.320000e-68 268
24 TraesCS2A01G360100 chr7A 87.850 214 25 1 614 827 308000420 308000208 1.570000e-62 250
25 TraesCS2A01G360100 chr7A 87.234 188 24 0 635 822 182522317 182522504 5.710000e-52 215
26 TraesCS2A01G360100 chr5A 87.745 1175 119 22 1477 2636 373902140 373900976 0.000000e+00 1349
27 TraesCS2A01G360100 chr5A 90.514 253 24 0 1118 1370 479311384 479311132 4.200000e-88 335
28 TraesCS2A01G360100 chr4A 87.766 1177 115 25 1477 2636 321274772 321275936 0.000000e+00 1349
29 TraesCS2A01G360100 chr4A 89.811 530 50 3 845 1370 389312723 389312194 0.000000e+00 676
30 TraesCS2A01G360100 chr4A 72.467 454 90 32 1 441 294170129 294169698 2.140000e-21 113
31 TraesCS2A01G360100 chr1A 87.489 1175 122 22 1477 2636 219891002 219889838 0.000000e+00 1332
32 TraesCS2A01G360100 chr1A 87.404 1175 123 22 1477 2636 556150889 556152053 0.000000e+00 1327
33 TraesCS2A01G360100 chr1A 91.391 453 32 5 1 448 322636112 322635662 4.820000e-172 614
34 TraesCS2A01G360100 chr1A 85.950 484 53 3 893 1361 164740180 164740663 1.090000e-138 503
35 TraesCS2A01G360100 chr1A 87.442 430 37 15 1 421 255632323 255632744 1.840000e-131 479
36 TraesCS2A01G360100 chr1A 86.543 431 40 16 1 421 255617532 255617954 2.390000e-125 459
37 TraesCS2A01G360100 chr1A 86.480 429 42 14 1 421 241758114 241758534 8.600000e-125 457
38 TraesCS2A01G360100 chr1A 92.727 110 4 4 413 521 509453484 509453590 3.510000e-34 156
39 TraesCS2A01G360100 chr1A 90.909 110 6 4 413 521 509445569 509445675 7.600000e-31 145
40 TraesCS2A01G360100 chr6A 87.810 484 43 4 893 1361 157320921 157320439 1.070000e-153 553
41 TraesCS2A01G360100 chr6A 90.191 367 29 5 4 367 182816917 182817279 3.070000e-129 472
42 TraesCS2A01G360100 chr6A 89.646 367 31 5 4 367 372043144 372042782 6.650000e-126 460
43 TraesCS2A01G360100 chr6A 87.848 395 38 7 847 1236 206269757 206269368 3.090000e-124 455
44 TraesCS2A01G360100 chr6A 86.141 368 44 6 860 1223 248634276 248633912 8.850000e-105 390
45 TraesCS2A01G360100 chr6A 91.628 215 18 0 614 828 378279625 378279839 5.520000e-77 298
46 TraesCS2A01G360100 chr6A 88.785 214 24 0 611 824 378262046 378262259 2.010000e-66 263


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G360100 chr2A 604493566 604496201 2635 True 4868 4868 100.000 1 2636 1 chr2A.!!$R6 2635
1 TraesCS2A01G360100 chr2A 604501432 604504089 2657 True 4373 4373 96.501 1 2636 1 chr2A.!!$R7 2635
2 TraesCS2A01G360100 chr2A 454906000 454907274 1274 True 1365 1365 86.231 1359 2636 1 chr2A.!!$R5 1277
3 TraesCS2A01G360100 chr2A 327302904 327304068 1164 False 1354 1354 87.830 1477 2636 1 chr2A.!!$F1 1159
4 TraesCS2A01G360100 chr3A 271623859 271626523 2664 False 3982 3982 93.881 1 2632 1 chr3A.!!$F3 2631
5 TraesCS2A01G360100 chr3A 271616666 271618609 1943 False 2944 2944 94.148 708 2636 1 chr3A.!!$F2 1928
6 TraesCS2A01G360100 chr7A 396965017 396966085 1068 True 1391 1391 90.233 1570 2636 1 chr7A.!!$R3 1066
7 TraesCS2A01G360100 chr7A 298991292 298992452 1160 False 1336 1336 87.628 1477 2632 1 chr7A.!!$F2 1155
8 TraesCS2A01G360100 chr5A 373900976 373902140 1164 True 1349 1349 87.745 1477 2636 1 chr5A.!!$R1 1159
9 TraesCS2A01G360100 chr4A 321274772 321275936 1164 False 1349 1349 87.766 1477 2636 1 chr4A.!!$F1 1159
10 TraesCS2A01G360100 chr4A 389312194 389312723 529 True 676 676 89.811 845 1370 1 chr4A.!!$R2 525
11 TraesCS2A01G360100 chr1A 219889838 219891002 1164 True 1332 1332 87.489 1477 2636 1 chr1A.!!$R1 1159
12 TraesCS2A01G360100 chr1A 556150889 556152053 1164 False 1327 1327 87.404 1477 2636 1 chr1A.!!$F7 1159

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
984 1009 1.979155 CTCAGCCACGACCTCCTCA 60.979 63.158 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2426 2514 3.210857 CGCAAGGGAGAAGAACGAA 57.789 52.632 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 269 2.483877 CAGGCTCATTTTTGTGACGCTA 59.516 45.455 0.00 0.0 0.00 4.26
321 322 2.409948 ATCCCTCTCGGCTTTTCTTG 57.590 50.000 0.00 0.0 0.00 3.02
492 493 2.500504 ACTCCTTTTCTAACCCTAGCCG 59.499 50.000 0.00 0.0 0.00 5.52
659 660 3.314331 CCTCCGTGGTCAGGCACT 61.314 66.667 0.00 0.0 43.88 4.40
984 1009 1.979155 CTCAGCCACGACCTCCTCA 60.979 63.158 0.00 0.0 0.00 3.86
1244 1270 3.572584 GGTTACACGAGACACCAAGTAG 58.427 50.000 0.00 0.0 0.00 2.57
1357 1383 4.022359 ACCCCCAAGTACCTCTATGAAT 57.978 45.455 0.00 0.0 0.00 2.57
1378 1405 2.629137 TGGAAACGCCAAGTACTCTACA 59.371 45.455 0.00 0.0 45.87 2.74
1401 1428 1.927174 CGAAGACGCCTAAGACCATTG 59.073 52.381 0.00 0.0 0.00 2.82
1573 1600 0.029035 CGACTATGAACGTCCCGAGG 59.971 60.000 0.00 0.0 0.00 4.63
2035 2120 4.920129 ACTAAGGCATATGGGGATTTACCT 59.080 41.667 4.56 0.0 38.98 3.08
2104 2189 4.076394 TGTAGTTTTGTTATGCCTCACCC 58.924 43.478 0.00 0.0 0.00 4.61
2359 2447 1.082104 CCGGTGTTTGCTTCTTCGC 60.082 57.895 0.00 0.0 0.00 4.70
2426 2514 4.003648 GTCCGTTTGTCTTCTTCATGGAT 58.996 43.478 0.00 0.0 0.00 3.41
2437 2525 6.035542 GTCTTCTTCATGGATTCGTTCTTCTC 59.964 42.308 0.00 0.0 0.00 2.87
2608 2697 4.331968 CACCTTGTCCTAGCAAACCATTA 58.668 43.478 0.00 0.0 0.00 1.90
2632 2721 1.743394 GGCTATGTTACCGCTTTGCTT 59.257 47.619 0.00 0.0 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
787 788 2.653115 CGAGCAGCAGAGTCACCA 59.347 61.111 0.00 0.00 0.00 4.17
858 881 3.402681 GCAGCAGGGGTAGAGGCA 61.403 66.667 0.00 0.00 0.00 4.75
984 1009 0.836400 ACATGGAGAGGGTCGTGGTT 60.836 55.000 0.00 0.00 0.00 3.67
1244 1270 2.432628 CTTGGAGGACCGTCGTGC 60.433 66.667 5.84 5.84 39.42 5.34
1332 1358 2.127651 AGAGGTACTTGGGGGTTTCA 57.872 50.000 0.00 0.00 41.55 2.69
1357 1383 2.629137 TGTAGAGTACTTGGCGTTTCCA 59.371 45.455 0.00 0.00 44.85 3.53
1401 1428 1.859080 GTTGTACTCGATGAATCCCGC 59.141 52.381 0.00 0.00 0.00 6.13
1573 1600 5.808030 GTGCAAAGTAGAGGAAGTAGATGTC 59.192 44.000 0.00 0.00 0.00 3.06
1939 2019 6.486320 TGCAGATGACATGAACAAGTTTAAGA 59.514 34.615 0.00 0.00 0.00 2.10
2035 2120 7.308109 GGGCCGAATATAACAAATAACGAATCA 60.308 37.037 0.00 0.00 0.00 2.57
2426 2514 3.210857 CGCAAGGGAGAAGAACGAA 57.789 52.632 0.00 0.00 0.00 3.85
2608 2697 3.428862 GCAAAGCGGTAACATAGCCAAAT 60.429 43.478 0.00 0.00 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.