Multiple sequence alignment - TraesCS2A01G341200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G341200 chr2A 100.000 2393 0 0 1 2393 576968068 576965676 0 4420
1 TraesCS2A01G341200 chr2A 96.172 1071 37 3 1323 2393 663123599 663124665 0 1748
2 TraesCS2A01G341200 chr7A 97.384 1338 33 2 1 1337 259691857 259690521 0 2276
3 TraesCS2A01G341200 chr7A 97.384 1338 33 2 1 1337 495140961 495139625 0 2276
4 TraesCS2A01G341200 chr7A 95.903 1074 38 5 1323 2393 259690490 259689420 0 1735
5 TraesCS2A01G341200 chr5A 97.662 1326 30 1 1 1325 342745433 342746758 0 2276
6 TraesCS2A01G341200 chr1A 97.662 1326 29 2 1 1325 350851382 350852706 0 2276
7 TraesCS2A01G341200 chr1A 97.235 1338 36 1 1 1337 458680812 458679475 0 2265
8 TraesCS2A01G341200 chr1A 97.436 1326 33 1 1 1325 302281557 302282882 0 2259
9 TraesCS2A01G341200 chr1A 95.993 1073 35 4 1323 2393 302282925 302283991 0 1736
10 TraesCS2A01G341200 chr4A 97.237 1339 35 2 1 1337 86492819 86491481 0 2266
11 TraesCS2A01G341200 chr4A 96.359 1071 33 4 1323 2393 81352760 81351696 0 1757
12 TraesCS2A01G341200 chr4A 96.179 1073 37 2 1323 2393 75108150 75109220 0 1751
13 TraesCS2A01G341200 chr4A 96.089 1074 34 5 1320 2393 62475385 62474320 0 1744
14 TraesCS2A01G341200 chr4A 96.078 1071 37 4 1323 2393 115018044 115016979 0 1740
15 TraesCS2A01G341200 chr7B 97.235 1338 35 2 1 1337 559363028 559361692 0 2265
16 TraesCS2A01G341200 chr3A 97.235 1338 36 1 1 1337 692071454 692070117 0 2265
17 TraesCS2A01G341200 chr6A 95.222 1214 54 4 804 2016 214445683 214444473 0 1917
18 TraesCS2A01G341200 chr6A 96.552 1073 31 5 1323 2393 377060929 377059861 0 1772


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G341200 chr2A 576965676 576968068 2392 True 4420.0 4420 100.0000 1 2393 1 chr2A.!!$R1 2392
1 TraesCS2A01G341200 chr2A 663123599 663124665 1066 False 1748.0 1748 96.1720 1323 2393 1 chr2A.!!$F1 1070
2 TraesCS2A01G341200 chr7A 495139625 495140961 1336 True 2276.0 2276 97.3840 1 1337 1 chr7A.!!$R1 1336
3 TraesCS2A01G341200 chr7A 259689420 259691857 2437 True 2005.5 2276 96.6435 1 2393 2 chr7A.!!$R2 2392
4 TraesCS2A01G341200 chr5A 342745433 342746758 1325 False 2276.0 2276 97.6620 1 1325 1 chr5A.!!$F1 1324
5 TraesCS2A01G341200 chr1A 350851382 350852706 1324 False 2276.0 2276 97.6620 1 1325 1 chr1A.!!$F1 1324
6 TraesCS2A01G341200 chr1A 458679475 458680812 1337 True 2265.0 2265 97.2350 1 1337 1 chr1A.!!$R1 1336
7 TraesCS2A01G341200 chr1A 302281557 302283991 2434 False 1997.5 2259 96.7145 1 2393 2 chr1A.!!$F2 2392
8 TraesCS2A01G341200 chr4A 86491481 86492819 1338 True 2266.0 2266 97.2370 1 1337 1 chr4A.!!$R3 1336
9 TraesCS2A01G341200 chr4A 81351696 81352760 1064 True 1757.0 1757 96.3590 1323 2393 1 chr4A.!!$R2 1070
10 TraesCS2A01G341200 chr4A 75108150 75109220 1070 False 1751.0 1751 96.1790 1323 2393 1 chr4A.!!$F1 1070
11 TraesCS2A01G341200 chr4A 62474320 62475385 1065 True 1744.0 1744 96.0890 1320 2393 1 chr4A.!!$R1 1073
12 TraesCS2A01G341200 chr4A 115016979 115018044 1065 True 1740.0 1740 96.0780 1323 2393 1 chr4A.!!$R4 1070
13 TraesCS2A01G341200 chr7B 559361692 559363028 1336 True 2265.0 2265 97.2350 1 1337 1 chr7B.!!$R1 1336
14 TraesCS2A01G341200 chr3A 692070117 692071454 1337 True 2265.0 2265 97.2350 1 1337 1 chr3A.!!$R1 1336
15 TraesCS2A01G341200 chr6A 214444473 214445683 1210 True 1917.0 1917 95.2220 804 2016 1 chr6A.!!$R1 1212
16 TraesCS2A01G341200 chr6A 377059861 377060929 1068 True 1772.0 1772 96.5520 1323 2393 1 chr6A.!!$R2 1070

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
829 831 2.236395 AGCATTACCTTTACTGCCGAGT 59.764 45.455 0.0 0.0 35.05 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2344 2406 1.674359 TGACAACGACTTGCATTGGT 58.326 45.0 2.33 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 4.274459 GTGAACTCATCCCTATCAACATGC 59.726 45.833 0.00 0.00 0.00 4.06
285 286 3.070159 GGCTAGCATTCCAGTGTATCTCA 59.930 47.826 18.24 0.00 0.00 3.27
352 353 4.903054 TCTCAGATGTCTCATTGCTTGTT 58.097 39.130 0.00 0.00 0.00 2.83
762 764 3.120121 CGCAATGAGCTTAACAAAAGTGC 59.880 43.478 0.00 0.00 42.61 4.40
829 831 2.236395 AGCATTACCTTTACTGCCGAGT 59.764 45.455 0.00 0.00 35.05 4.18
1120 1123 7.418337 TGTATAGTTGCTAAACATCTCTGGA 57.582 36.000 0.00 0.00 38.88 3.86
1140 1143 5.588845 TGGACCCACATTGAGGAATATTTT 58.411 37.500 1.20 0.00 0.00 1.82
1256 1259 5.044476 TCCTTTGGTGCCTCTGGAAATATAA 60.044 40.000 0.00 0.00 0.00 0.98
1338 1386 2.554032 CGGGAACAAGTTGATGAGCTTT 59.446 45.455 10.54 0.00 0.00 3.51
1380 1428 0.250553 TCCAGAAACCGTTGGCGATT 60.251 50.000 0.00 0.00 41.33 3.34
1615 1664 5.411831 TGTGTCATTTGAGTGCTCTATCT 57.588 39.130 0.68 0.00 0.00 1.98
1964 2020 6.037172 GCACGAAAATCCTAGTGATTGTGTAT 59.963 38.462 15.88 0.58 42.97 2.29
2075 2132 2.457813 TGATAACATTGCTGGCCCAT 57.542 45.000 0.00 0.00 0.00 4.00
2261 2320 5.178623 TGACTGTAAATTCTACCACGCAAAG 59.821 40.000 0.00 0.00 0.00 2.77
2262 2321 5.302360 ACTGTAAATTCTACCACGCAAAGA 58.698 37.500 0.00 0.00 0.00 2.52
2330 2392 2.673775 TTTGGAGGCTGAAATGTGGA 57.326 45.000 0.00 0.00 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 4.669206 AGTCAGCTAACTCCTGATCATG 57.331 45.455 0.00 0.0 41.01 3.07
285 286 6.704056 TTTAGGGAACTTGAAGAAGGAGAT 57.296 37.500 0.00 0.0 43.67 2.75
313 314 6.119240 TCTGAGAATTGATGAGGTTCACTT 57.881 37.500 0.00 0.0 0.00 3.16
352 353 7.147846 GCTTCCTATTTCCCTCAAAATCATTCA 60.148 37.037 0.00 0.0 31.50 2.57
427 428 1.700955 GAGGTTAGGTATGCCGAGGA 58.299 55.000 0.00 0.0 40.50 3.71
431 432 1.760613 TCTTGGAGGTTAGGTATGCCG 59.239 52.381 0.00 0.0 40.50 5.69
982 984 8.359642 CCTAGTCATCAATTTGTTTTTGGAGAA 58.640 33.333 0.00 0.0 0.00 2.87
1051 1053 5.625150 AGACTCTTGTTCCAAGCAGTAAAT 58.375 37.500 0.00 0.0 0.00 1.40
1120 1123 8.116026 ACTAGAAAAATATTCCTCAATGTGGGT 58.884 33.333 0.00 0.0 0.00 4.51
1140 1143 4.293494 AGGATGAGCCAATCTGACTAGAA 58.707 43.478 0.00 0.0 40.02 2.10
1256 1259 8.806146 AGGTGTTACTGAAAATCATAGCATTTT 58.194 29.630 0.00 0.0 38.43 1.82
1338 1386 3.245122 GGGATCTTGTTAGGGTTTCCACA 60.245 47.826 0.00 0.0 34.83 4.17
1431 1480 6.606395 TCATCTTCATCAGAGATCTTGAGACA 59.394 38.462 0.00 0.0 33.87 3.41
1470 1519 2.290071 GGTGGATGTCCCTCTTTTTCGA 60.290 50.000 0.00 0.0 35.38 3.71
1634 1683 7.223584 TCTCTGAATAACACAAATCACCTGAA 58.776 34.615 0.00 0.0 0.00 3.02
1637 1686 7.227156 AGTTCTCTGAATAACACAAATCACCT 58.773 34.615 5.63 0.0 0.00 4.00
1688 1740 5.820947 AGTTCGAAAGCAAAGGTAGAAAAGA 59.179 36.000 0.00 0.0 0.00 2.52
1964 2020 7.879160 TCGTCCTTAAATCTTACCAAGCTTTTA 59.121 33.333 0.00 0.0 30.33 1.52
2075 2132 7.669722 GGGCTGATTCTAATTATAATGTTGGGA 59.330 37.037 0.00 0.0 0.00 4.37
2344 2406 1.674359 TGACAACGACTTGCATTGGT 58.326 45.000 2.33 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.