AutoCloner

Multiple sequence alignment - TraesCS2A01G338800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2A01G338800	chr2A	100.000	3526	0	0	1	3526	572749390	572745865	0.000000e+00	6512.0
1	TraesCS2A01G338800	chr2A	84.502	884	126	6	1037	1919	572842292	572841419	0.000000e+00	863.0
2	TraesCS2A01G338800	chr2A	83.091	550	81	4	1979	2516	572841320	572840771	1.140000e-134	490.0
3	TraesCS2A01G338800	chr2A	77.743	647	102	34	1301	1927	572707835	572707211	3.350000e-95	359.0
4	TraesCS2A01G338800	chr2A	77.558	303	56	10	83	381	25602994	25603288	4.680000e-39	172.0
5	TraesCS2A01G338800	chr2B	90.096	1555	57	29	463	1969	489015065	489016570	0.000000e+00	1929.0
6	TraesCS2A01G338800	chr2B	96.439	674	19	2	1969	2640	489016606	489017276	0.000000e+00	1107.0
7	TraesCS2A01G338800	chr2B	84.329	887	127	7	1037	1919	488994776	488995654	0.000000e+00	857.0
8	TraesCS2A01G338800	chr2B	83.636	550	76	5	1967	2504	488995729	488996276	4.060000e-139	505.0
9	TraesCS2A01G338800	chr2B	76.205	643	119	27	1301	1927	489029563	489030187	3.420000e-80	309.0
10	TraesCS2A01G338800	chr2B	91.371	197	13	4	2886	3078	489017345	489017541	2.090000e-67	267.0
11	TraesCS2A01G338800	chr2B	84.375	224	12	8	3200	3408	489017828	489018043	7.720000e-47	198.0
12	TraesCS2A01G338800	chr2D	89.723	1479	76	26	532	1970	417183058	417184500	0.000000e+00	1820.0
13	TraesCS2A01G338800	chr2D	94.866	857	31	5	1968	2824	417184533	417185376	0.000000e+00	1327.0
14	TraesCS2A01G338800	chr2D	84.389	884	129	4	1037	1919	417086404	417087279	0.000000e+00	859.0
15	TraesCS2A01G338800	chr2D	83.549	541	77	5	1976	2504	417087375	417087915	2.440000e-136	496.0
16	TraesCS2A01G338800	chr2D	77.019	644	112	30	1301	1927	417210691	417211315	1.570000e-88	337.0
17	TraesCS2A01G338800	chr2D	92.050	239	17	1	2784	3020	417185380	417185618	5.640000e-88	335.0
18	TraesCS2A01G338800	chr2D	82.081	346	28	12	229	545	417167646	417167986	7.510000e-67	265.0
19	TraesCS2A01G338800	chr2D	97.561	41	0	1	3025	3064	417185881	417185921	6.320000e-08	69.4
20	TraesCS2A01G338800	chrUn	77.888	303	55	10	83	381	228440297	228440591	1.010000e-40	178.0
21	TraesCS2A01G338800	chrUn	77.228	303	59	9	76	374	19837650	19837354	6.050000e-38	169.0
22	TraesCS2A01G338800	chr3D	77.228	303	58	10	77	375	614236066	614236361	2.180000e-37	167.0
23	TraesCS2A01G338800	chr6A	78.544	261	44	10	79	334	12212987	12212734	1.010000e-35	161.0
24	TraesCS2A01G338800	chr6A	75.415	301	63	10	78	374	357407711	357407418	6.140000e-28	135.0
25	TraesCS2A01G338800	chr1D	76.821	302	59	10	78	374	7360068	7359773	3.640000e-35	159.0
26	TraesCS2A01G338800	chr5B	80.588	170	22	7	79	243	860303	860466	1.720000e-23	121.0
27	TraesCS2A01G338800	chr5B	80.357	168	23	7	80	243	400664520	400664359	6.180000e-23	119.0
28	TraesCS2A01G338800	chr7A	79.747	158	23	8	2890	3040	584372179	584372334	4.810000e-19	106.0
29	TraesCS2A01G338800	chr7B	82.114	123	14	8	2957	3074	707607959	707608078	8.060000e-17	99.0
30	TraesCS2A01G338800	chr7D	78.710	155	20	11	3176	3322	590816512	590816661	1.350000e-14	91.6

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2A01G338800	chr2A	572745865	572749390	3525	True	6512.00	6512	100.00000	1	3526	1	chr2A.!!$R2	3525
1	TraesCS2A01G338800	chr2A	572840771	572842292	1521	True	676.50	863	83.79650	1037	2516	2	chr2A.!!$R3	1479
2	TraesCS2A01G338800	chr2A	572707211	572707835	624	True	359.00	359	77.74300	1301	1927	1	chr2A.!!$R1	626
3	TraesCS2A01G338800	chr2B	489015065	489018043	2978	False	875.25	1929	90.57025	463	3408	4	chr2B.!!$F3	2945
4	TraesCS2A01G338800	chr2B	488994776	488996276	1500	False	681.00	857	83.98250	1037	2504	2	chr2B.!!$F2	1467
5	TraesCS2A01G338800	chr2B	489029563	489030187	624	False	309.00	309	76.20500	1301	1927	1	chr2B.!!$F1	626
6	TraesCS2A01G338800	chr2D	417183058	417185921	2863	False	887.85	1820	93.55000	532	3064	4	chr2D.!!$F4	2532
7	TraesCS2A01G338800	chr2D	417086404	417087915	1511	False	677.50	859	83.96900	1037	2504	2	chr2D.!!$F3	1467
8	TraesCS2A01G338800	chr2D	417210691	417211315	624	False	337.00	337	77.01900	1301	1927	1	chr2D.!!$F2	626

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
194	195	0.034059	GTGAATCCCGGCGATGAGAT	59.966	55.0	9.3	1.84	0.00	2.75	F
460	461	0.037232	AGGGAAGAAAGAAGACGCCG	60.037	55.0	0.0	0.00	0.00	6.46	F
1290	1385	0.531974	ATTCACACCGTGCGACACTT	60.532	50.0	0.0	0.00	32.98	3.16	F

Position	MSA Position	Penalty	Sequence	TM	GC	Hairpin	End Stability	Orientation
1947	2047	0.035725	CCATCTTCAGCAGCAGACCA	60.036	55.0	0.00	4.02	R
2054	2205	0.309922	CGTCGCCGTACATGAGGTAT	59.690	55.0	33.76	2.73	R
3074	3544	0.179227	CACACACACACACACACACG	60.179	55.0	0.00	4.49	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	End Stability
22	23	5.523438	TTTTTGCTACCACCGAAGAATTT	57.477	34.783	1.82
23	24	5.523438	TTTTGCTACCACCGAAGAATTTT	57.477	34.783	1.82
24	25	5.523438	TTTGCTACCACCGAAGAATTTTT	57.477	34.783	1.94
45	46	6.811253	TTTTGCTACATCCATTTTACGACT	57.189	33.333	4.18
46	47	6.811253	TTTGCTACATCCATTTTACGACTT	57.189	33.333	3.01
47	48	7.908827	TTTGCTACATCCATTTTACGACTTA	57.091	32.000	2.24
48	49	6.897259	TGCTACATCCATTTTACGACTTAC	57.103	37.500	2.34
49	50	5.813672	TGCTACATCCATTTTACGACTTACC	59.186	40.000	2.85
50	51	6.047231	GCTACATCCATTTTACGACTTACCT	58.953	40.000	3.08
51	52	7.147863	TGCTACATCCATTTTACGACTTACCTA	60.148	37.037	3.08
52	53	7.168804	GCTACATCCATTTTACGACTTACCTAC	59.831	40.741	3.18
53	54	6.038356	ACATCCATTTTACGACTTACCTACG	58.962	40.000	3.51
54	55	5.895636	TCCATTTTACGACTTACCTACGA	57.104	39.130	3.43
55	56	5.640732	TCCATTTTACGACTTACCTACGAC	58.359	41.667	4.34
56	57	4.800471	CCATTTTACGACTTACCTACGACC	59.200	45.833	4.79
57	58	4.434713	TTTTACGACTTACCTACGACCC	57.565	45.455	4.46
58	59	2.038387	TACGACTTACCTACGACCCC	57.962	55.000	4.95
59	60	0.681243	ACGACTTACCTACGACCCCC	60.681	60.000	5.40
60	61	0.680921	CGACTTACCTACGACCCCCA	60.681	60.000	4.96
61	62	1.560505	GACTTACCTACGACCCCCAA	58.439	55.000	4.12
62	63	1.901833	GACTTACCTACGACCCCCAAA	59.098	52.381	3.28
63	64	1.625315	ACTTACCTACGACCCCCAAAC	59.375	52.381	2.93
64	65	1.624813	CTTACCTACGACCCCCAAACA	59.375	52.381	2.83
65	66	1.269012	TACCTACGACCCCCAAACAG	58.731	55.000	3.16
66	67	1.376812	CCTACGACCCCCAAACAGC	60.377	63.158	4.40

Showing 1 to 25 of 433 entries

Previous1 2 3 4 5…18Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	End Stability
0	1	5.523438	AAATTCTTCGGTGGTAGCAAAAA	57.477	34.783	1.94
1	2	5.523438	AAAATTCTTCGGTGGTAGCAAAA	57.477	34.783	2.44
2	3	5.523438	AAAAATTCTTCGGTGGTAGCAAA	57.477	34.783	3.68
21	22	7.209471	AGTCGTAAAATGGATGTAGCAAAAA	57.791	32.000	1.94
22	23	6.811253	AGTCGTAAAATGGATGTAGCAAAA	57.189	33.333	2.44
23	24	6.811253	AAGTCGTAAAATGGATGTAGCAAA	57.189	33.333	3.68
24	25	6.314400	GGTAAGTCGTAAAATGGATGTAGCAA	59.686	38.462	3.91
25	26	5.813672	GGTAAGTCGTAAAATGGATGTAGCA	59.186	40.000	3.49
26	27	6.047231	AGGTAAGTCGTAAAATGGATGTAGC	58.953	40.000	3.58
27	28	7.377928	CGTAGGTAAGTCGTAAAATGGATGTAG	59.622	40.741	2.74
28	29	7.066887	TCGTAGGTAAGTCGTAAAATGGATGTA	59.933	37.037	2.29
29	30	6.038356	CGTAGGTAAGTCGTAAAATGGATGT	58.962	40.000	3.06
30	31	6.197842	GTCGTAGGTAAGTCGTAAAATGGATG	59.802	42.308	3.51
31	32	6.268566	GTCGTAGGTAAGTCGTAAAATGGAT	58.731	40.000	3.41
32	33	5.393027	GGTCGTAGGTAAGTCGTAAAATGGA	60.393	44.000	3.41
33	34	4.800471	GGTCGTAGGTAAGTCGTAAAATGG	59.200	45.833	3.16
34	35	4.800471	GGGTCGTAGGTAAGTCGTAAAATG	59.200	45.833	2.32
35	36	4.142160	GGGGTCGTAGGTAAGTCGTAAAAT	60.142	45.833	1.82
36	37	3.192633	GGGGTCGTAGGTAAGTCGTAAAA	59.807	47.826	1.52
37	38	2.752903	GGGGTCGTAGGTAAGTCGTAAA	59.247	50.000	2.01
38	39	2.365582	GGGGTCGTAGGTAAGTCGTAA	58.634	52.381	3.18
39	40	1.408266	GGGGGTCGTAGGTAAGTCGTA	60.408	57.143	3.43
40	41	0.681243	GGGGGTCGTAGGTAAGTCGT	60.681	60.000	4.34
41	42	0.680921	TGGGGGTCGTAGGTAAGTCG	60.681	60.000	4.18
42	43	1.560505	TTGGGGGTCGTAGGTAAGTC	58.439	55.000	3.01

Showing 1 to 25 of 485 entries

Previous1 2 3 4 5…20Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.