Multiple sequence alignment - TraesCS2A01G337500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G337500 chr2A 100.000 1434 0 0 861 2294 571019198 571020631 0 2649
1 TraesCS2A01G337500 chr2A 96.936 1436 41 3 861 2294 23796249 23797683 0 2405
2 TraesCS2A01G337500 chr2A 96.736 1440 41 2 861 2294 600113369 600111930 0 2394
3 TraesCS2A01G337500 chr2A 100.000 571 0 0 1 571 571018338 571018908 0 1055
4 TraesCS2A01G337500 chr2A 93.902 574 31 3 1 571 23795333 23795905 0 863
5 TraesCS2A01G337500 chr2A 93.982 565 17 7 1 561 600114413 600113862 0 839
6 TraesCS2A01G337500 chr7A 97.145 1436 39 2 861 2294 707844455 707845890 0 2423
7 TraesCS2A01G337500 chr7A 96.588 1436 47 2 861 2294 650324495 650323060 0 2379
8 TraesCS2A01G337500 chr7A 96.448 1436 47 4 861 2294 650260679 650259246 0 2366
9 TraesCS2A01G337500 chr7A 96.161 573 20 2 1 571 650261683 650261111 0 935
10 TraesCS2A01G337500 chr7A 96.154 572 20 2 1 571 707843423 707843993 0 933
11 TraesCS2A01G337500 chr7A 93.786 515 29 3 1 512 650325359 650324845 0 771
12 TraesCS2A01G337500 chr1A 96.441 1433 49 2 861 2291 380400877 380402309 0 2362
13 TraesCS2A01G337500 chr1A 95.477 1437 60 5 861 2294 531839986 531838552 0 2289
14 TraesCS2A01G337500 chr1A 96.522 575 15 4 1 571 11027119 11026546 0 946
15 TraesCS2A01G337500 chr1B 95.546 1437 59 5 861 2294 658504067 658502633 0 2294
16 TraesCS2A01G337500 chr4A 94.638 1436 73 4 861 2294 382145541 382146974 0 2222
17 TraesCS2A01G337500 chr5A 95.986 573 21 1 1 571 603018400 603018972 0 929
18 TraesCS2A01G337500 chr5A 95.986 573 20 3 1 571 507566518 507565947 0 928
19 TraesCS2A01G337500 chrUn 95.709 536 21 2 1 534 248381407 248380872 0 861


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G337500 chr2A 571018338 571020631 2293 False 1852.0 2649 100.0000 1 2294 2 chr2A.!!$F2 2293
1 TraesCS2A01G337500 chr2A 23795333 23797683 2350 False 1634.0 2405 95.4190 1 2294 2 chr2A.!!$F1 2293
2 TraesCS2A01G337500 chr2A 600111930 600114413 2483 True 1616.5 2394 95.3590 1 2294 2 chr2A.!!$R1 2293
3 TraesCS2A01G337500 chr7A 707843423 707845890 2467 False 1678.0 2423 96.6495 1 2294 2 chr7A.!!$F1 2293
4 TraesCS2A01G337500 chr7A 650259246 650261683 2437 True 1650.5 2366 96.3045 1 2294 2 chr7A.!!$R1 2293
5 TraesCS2A01G337500 chr7A 650323060 650325359 2299 True 1575.0 2379 95.1870 1 2294 2 chr7A.!!$R2 2293
6 TraesCS2A01G337500 chr1A 380400877 380402309 1432 False 2362.0 2362 96.4410 861 2291 1 chr1A.!!$F1 1430
7 TraesCS2A01G337500 chr1A 531838552 531839986 1434 True 2289.0 2289 95.4770 861 2294 1 chr1A.!!$R2 1433
8 TraesCS2A01G337500 chr1A 11026546 11027119 573 True 946.0 946 96.5220 1 571 1 chr1A.!!$R1 570
9 TraesCS2A01G337500 chr1B 658502633 658504067 1434 True 2294.0 2294 95.5460 861 2294 1 chr1B.!!$R1 1433
10 TraesCS2A01G337500 chr4A 382145541 382146974 1433 False 2222.0 2222 94.6380 861 2294 1 chr4A.!!$F1 1433
11 TraesCS2A01G337500 chr5A 603018400 603018972 572 False 929.0 929 95.9860 1 571 1 chr5A.!!$F1 570
12 TraesCS2A01G337500 chr5A 507565947 507566518 571 True 928.0 928 95.9860 1 571 1 chr5A.!!$R1 570
13 TraesCS2A01G337500 chrUn 248380872 248381407 535 True 861.0 861 95.7090 1 534 1 chrUn.!!$R1 533

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
555 564 1.168407 GCTGCTCTTGACCTGCAACA 61.168 55.0 0.0 0.0 36.22 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1838 2248 0.240945 AAAGCTTGCCATGCGTGTAC 59.759 50.0 0.0 0.0 35.28 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
184 187 9.416284 AGTTTGTTATTTTTCCTAGGAACTTGA 57.584 29.630 24.21 6.62 41.75 3.02
303 309 1.575447 GGCAGAACCTCCCTTCCCAT 61.575 60.000 0.00 0.00 34.51 4.00
346 355 2.106683 GCCGTCCACACCATACAGC 61.107 63.158 0.00 0.00 0.00 4.40
363 372 4.851639 ACAGCTCCAATGTCTCCTAAAT 57.148 40.909 0.00 0.00 0.00 1.40
426 435 3.756783 CCCTCTCCCTCTCCCCGT 61.757 72.222 0.00 0.00 0.00 5.28
555 564 1.168407 GCTGCTCTTGACCTGCAACA 61.168 55.000 0.00 0.00 36.22 3.33
896 1303 4.401519 CAGATCCAGAGCACAAATCCAAAT 59.598 41.667 0.00 0.00 0.00 2.32
1040 1448 4.828296 GGACCCCCTCCGCGAGTA 62.828 72.222 8.23 0.00 0.00 2.59
1069 1477 4.719369 GCGTCCGCCTCGTCAAGT 62.719 66.667 0.00 0.00 34.56 3.16
1279 1687 3.735720 TCCCCATCAACAACATCATCA 57.264 42.857 0.00 0.00 0.00 3.07
1642 2052 6.957911 GAAAGAGGAGCTTTTGCAATGTTTCT 60.958 38.462 0.00 0.00 46.52 2.52
1649 2059 6.110543 GCTTTTGCAATGTTTCTCTGTTTT 57.889 33.333 0.00 0.00 46.58 2.43
2201 2620 2.419436 CCGATATGTGTGGTGCCAACTA 60.419 50.000 0.00 0.00 0.00 2.24
2251 2670 9.515226 AATAGTCTTTTGGTTCATACAGCTTAA 57.485 29.630 0.00 0.00 0.00 1.85
2269 2688 7.338703 ACAGCTTAATGCCTCATATATGAATGG 59.661 37.037 16.08 14.97 44.23 3.16
2272 2691 7.337689 GCTTAATGCCTCATATATGAATGGTCA 59.662 37.037 16.08 15.17 36.18 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
184 187 2.677836 GCGTTGTGTCATCATATGTGGT 59.322 45.455 1.90 0.00 0.00 4.16
233 239 5.798125 TTGAAACAGGCATAACAAATCCA 57.202 34.783 0.00 0.00 0.00 3.41
234 240 7.387397 TCATTTTGAAACAGGCATAACAAATCC 59.613 33.333 0.00 0.00 0.00 3.01
235 241 8.223100 GTCATTTTGAAACAGGCATAACAAATC 58.777 33.333 0.00 0.00 0.00 2.17
303 309 2.070039 CGGCTTAGGGGGTGATCCA 61.070 63.158 0.00 0.00 37.22 3.41
346 355 3.310774 CGTGCATTTAGGAGACATTGGAG 59.689 47.826 0.00 0.00 0.00 3.86
868 1275 0.967380 TGTGCTCTGGATCTGCGAGA 60.967 55.000 9.57 0.00 0.00 4.04
896 1303 2.125310 CGGGCGAATGGTGTGCTA 60.125 61.111 0.00 0.00 0.00 3.49
963 1371 2.354539 GCGAGATCTCAGAGCCGC 60.355 66.667 22.31 15.10 32.91 6.53
1176 1584 4.081050 GCCACCTTGGTGAACTCC 57.919 61.111 20.27 1.06 40.46 3.85
1204 1612 3.560668 CCCATGATGATGAACCCGATCAT 60.561 47.826 0.00 0.00 42.15 2.45
1219 1627 1.910580 AAGCCGACGAACCCCATGAT 61.911 55.000 0.00 0.00 0.00 2.45
1279 1687 3.227276 CACCTAGCCGGAGCCGAT 61.227 66.667 5.05 1.13 42.83 4.18
1617 2027 4.248691 ACATTGCAAAAGCTCCTCTTTC 57.751 40.909 1.71 0.00 43.84 2.62
1642 2052 3.291584 TGGTGGTATGTGCAAAAACAGA 58.708 40.909 0.00 0.00 32.52 3.41
1649 2059 1.518325 CGAACTGGTGGTATGTGCAA 58.482 50.000 0.00 0.00 0.00 4.08
1838 2248 0.240945 AAAGCTTGCCATGCGTGTAC 59.759 50.000 0.00 0.00 35.28 2.90
2201 2620 4.338879 ACATCAGCTAGCAAAGAAATGGT 58.661 39.130 18.83 0.00 34.89 3.55
2251 2670 7.876936 GAATGACCATTCATATATGAGGCAT 57.123 36.000 17.06 15.28 42.00 4.40
2269 2688 7.643528 GAGAAATTGAAAAACCCAGAATGAC 57.356 36.000 0.00 0.00 39.69 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.