Multiple sequence alignment - TraesCS2A01G330800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G330800 chr2A 100.000 2300 0 0 1 2300 563261173 563258874 0.000000e+00 4248.0
1 TraesCS2A01G330800 chr2A 98.479 2301 34 1 1 2300 735141324 735139024 0.000000e+00 4054.0
2 TraesCS2A01G330800 chr2A 98.816 591 7 0 1710 2300 605910053 605910643 0.000000e+00 1053.0
3 TraesCS2A01G330800 chr2A 98.582 141 2 0 1859 1999 588462290 588462430 1.360000e-62 250.0
4 TraesCS2A01G330800 chr2A 96.842 95 3 0 2201 2295 199191610 199191516 2.370000e-35 159.0
5 TraesCS2A01G330800 chr2A 100.000 77 0 0 1447 1523 94207910 94207834 2.380000e-30 143.0
6 TraesCS2A01G330800 chr1B 99.391 2300 14 0 1 2300 683729610 683731909 0.000000e+00 4170.0
7 TraesCS2A01G330800 chr7B 99.043 2300 22 0 1 2300 698144693 698142394 0.000000e+00 4126.0
8 TraesCS2A01G330800 chr6B 99.000 2300 23 0 1 2300 128916648 128914349 0.000000e+00 4120.0
9 TraesCS2A01G330800 chr3B 98.913 2300 25 0 1 2300 92266388 92264089 0.000000e+00 4109.0
10 TraesCS2A01G330800 chr3B 98.870 2301 25 1 1 2300 5082608 5084908 0.000000e+00 4104.0
11 TraesCS2A01G330800 chr7A 97.352 1322 30 1 974 2295 563533437 563534753 0.000000e+00 2242.0
12 TraesCS2A01G330800 chr7A 99.322 737 5 0 1 737 671976341 671975605 0.000000e+00 1334.0
13 TraesCS2A01G330800 chr7A 99.186 737 6 0 1 737 671991685 671992421 0.000000e+00 1328.0
14 TraesCS2A01G330800 chr7A 93.303 881 56 1 1 878 211227482 211228362 0.000000e+00 1297.0
15 TraesCS2A01G330800 chr7A 94.245 139 7 1 981 1118 705544731 705544869 6.440000e-51 211.0
16 TraesCS2A01G330800 chr7A 98.077 52 1 0 1984 2035 60277536 60277485 8.750000e-15 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G330800 chr2A 563258874 563261173 2299 True 4248 4248 100.000 1 2300 1 chr2A.!!$R3 2299
1 TraesCS2A01G330800 chr2A 735139024 735141324 2300 True 4054 4054 98.479 1 2300 1 chr2A.!!$R4 2299
2 TraesCS2A01G330800 chr2A 605910053 605910643 590 False 1053 1053 98.816 1710 2300 1 chr2A.!!$F2 590
3 TraesCS2A01G330800 chr1B 683729610 683731909 2299 False 4170 4170 99.391 1 2300 1 chr1B.!!$F1 2299
4 TraesCS2A01G330800 chr7B 698142394 698144693 2299 True 4126 4126 99.043 1 2300 1 chr7B.!!$R1 2299
5 TraesCS2A01G330800 chr6B 128914349 128916648 2299 True 4120 4120 99.000 1 2300 1 chr6B.!!$R1 2299
6 TraesCS2A01G330800 chr3B 92264089 92266388 2299 True 4109 4109 98.913 1 2300 1 chr3B.!!$R1 2299
7 TraesCS2A01G330800 chr3B 5082608 5084908 2300 False 4104 4104 98.870 1 2300 1 chr3B.!!$F1 2299
8 TraesCS2A01G330800 chr7A 563533437 563534753 1316 False 2242 2242 97.352 974 2295 1 chr7A.!!$F2 1321
9 TraesCS2A01G330800 chr7A 671975605 671976341 736 True 1334 1334 99.322 1 737 1 chr7A.!!$R2 736
10 TraesCS2A01G330800 chr7A 671991685 671992421 736 False 1328 1328 99.186 1 737 1 chr7A.!!$F3 736
11 TraesCS2A01G330800 chr7A 211227482 211228362 880 False 1297 1297 93.303 1 878 1 chr7A.!!$F1 877

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
843 847 2.119495 AGCTACCATGAAATCTCCGGT 58.881 47.619 0.0 0.0 32.55 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2135 2141 1.758592 GGGCACAAGTGGTCTGGTA 59.241 57.895 2.0 0.0 0.0 3.25 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
843 847 2.119495 AGCTACCATGAAATCTCCGGT 58.881 47.619 0.00 0.00 32.55 5.28
1533 1538 6.870439 CAGAAAATCTTCCAGTTTTCCATTCC 59.130 38.462 6.89 0.00 42.45 3.01
1750 1755 1.464997 GGGCAATCGTTGAGTGAACTC 59.535 52.381 3.41 3.41 43.15 3.01
2135 2141 1.043116 TCTGACCAATCGGCTCGGAT 61.043 55.000 0.00 0.00 34.57 4.18
2266 2272 1.884497 CGGCCAACACAACATTAGGGA 60.884 52.381 2.24 0.00 0.00 4.20
2295 2301 0.469917 CATTCTATGCTGACCCGGGT 59.530 55.000 30.81 30.81 0.00 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
824 825 2.158957 TCACCGGAGATTTCATGGTAGC 60.159 50.000 9.46 0.0 33.38 3.58
843 847 6.537301 AGAAGTAATCACAACGTCACTTTTCA 59.463 34.615 0.00 0.0 0.00 2.69
1533 1538 5.242393 CCATAAACTTTCCTGCCTCATATGG 59.758 44.000 2.13 0.0 33.52 2.74
1812 1817 1.855213 CTCGTCCCACGTACGGTTCA 61.855 60.000 21.06 0.0 43.14 3.18
2135 2141 1.758592 GGGCACAAGTGGTCTGGTA 59.241 57.895 2.00 0.0 0.00 3.25


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.