Multiple sequence alignment - TraesCS2A01G314000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G314000 chr2A 100.000 2513 0 0 1 2513 538373731 538371219 0 4641
1 TraesCS2A01G314000 chr6A 96.900 2516 66 11 1 2513 468224304 468226810 0 4204
2 TraesCS2A01G314000 chr5A 96.900 2516 65 11 1 2513 580225349 580222844 0 4202
3 TraesCS2A01G314000 chr5A 96.864 2519 65 11 1 2513 639808011 639810521 0 4202
4 TraesCS2A01G314000 chr5A 96.308 2519 78 10 1 2513 483355596 483353087 0 4122
5 TraesCS2A01G314000 chr1A 96.749 2522 64 12 1 2513 257591376 257588864 0 4187
6 TraesCS2A01G314000 chr1A 96.581 2515 67 10 1 2513 582806014 582808511 0 4150
7 TraesCS2A01G314000 chr3A 96.423 2516 74 10 1 2513 654166984 654169486 0 4133
8 TraesCS2A01G314000 chr3A 96.146 2517 82 13 1 2513 480296073 480298578 0 4096
9 TraesCS2A01G314000 chr4A 96.345 2517 80 9 1 2513 638451820 638449312 0 4128


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G314000 chr2A 538371219 538373731 2512 True 4641 4641 100.000 1 2513 1 chr2A.!!$R1 2512
1 TraesCS2A01G314000 chr6A 468224304 468226810 2506 False 4204 4204 96.900 1 2513 1 chr6A.!!$F1 2512
2 TraesCS2A01G314000 chr5A 580222844 580225349 2505 True 4202 4202 96.900 1 2513 1 chr5A.!!$R2 2512
3 TraesCS2A01G314000 chr5A 639808011 639810521 2510 False 4202 4202 96.864 1 2513 1 chr5A.!!$F1 2512
4 TraesCS2A01G314000 chr5A 483353087 483355596 2509 True 4122 4122 96.308 1 2513 1 chr5A.!!$R1 2512
5 TraesCS2A01G314000 chr1A 257588864 257591376 2512 True 4187 4187 96.749 1 2513 1 chr1A.!!$R1 2512
6 TraesCS2A01G314000 chr1A 582806014 582808511 2497 False 4150 4150 96.581 1 2513 1 chr1A.!!$F1 2512
7 TraesCS2A01G314000 chr3A 654166984 654169486 2502 False 4133 4133 96.423 1 2513 1 chr3A.!!$F2 2512
8 TraesCS2A01G314000 chr3A 480296073 480298578 2505 False 4096 4096 96.146 1 2513 1 chr3A.!!$F1 2512
9 TraesCS2A01G314000 chr4A 638449312 638451820 2508 True 4128 4128 96.345 1 2513 1 chr4A.!!$R1 2512

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
534 541 2.502538 CCCTAATAACCCCGTTGACTCA 59.497 50.0 0.00 0.00 0.0 3.41 F
1060 1070 0.038526 GCGGTTGACTTCGAAGGAGA 60.039 55.0 27.86 10.85 0.0 3.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1374 1384 1.201647 TCCGTCTTCAGTTCGACATCC 59.798 52.381 0.0 0.0 0.0 3.51 R
2486 2508 1.472480 GAGTTTGGTGTGTGTGTTGCT 59.528 47.619 0.0 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
37 38 9.582431 TTTAATTCAAAACCGTCAAATAACACA 57.418 25.926 0.00 0.00 0.00 3.72
534 541 2.502538 CCCTAATAACCCCGTTGACTCA 59.497 50.000 0.00 0.00 0.00 3.41
616 624 3.213402 CGCCAAACACCACCCGTT 61.213 61.111 0.00 0.00 0.00 4.44
655 663 2.849007 GATCCGCGTGATGCATCG 59.151 61.111 21.34 12.52 46.97 3.84
739 748 5.643379 ATTGTATTTTTCGCACATGACCT 57.357 34.783 0.00 0.00 0.00 3.85
821 831 7.394359 GCAAATCATCAATATAGCTTCCCCTTA 59.606 37.037 0.00 0.00 0.00 2.69
1060 1070 0.038526 GCGGTTGACTTCGAAGGAGA 60.039 55.000 27.86 10.85 0.00 3.71
1227 1237 3.877559 TCAGATCGTGAAGAAATGCCAT 58.122 40.909 0.00 0.00 29.64 4.40
1331 1341 0.700564 AATCTGCCCCATGACAGTGT 59.299 50.000 0.00 0.00 35.37 3.55
1374 1384 1.153509 GGAATACCCGACGGTGGTG 60.154 63.158 13.94 0.00 44.40 4.17
1445 1455 3.752222 CAGCTGATTGAGTTGAAGAAGCT 59.248 43.478 8.42 0.00 40.25 3.74
1568 1581 6.648192 AGGAATCCAAGTCTGTTTATCTCAG 58.352 40.000 0.61 0.00 0.00 3.35
1661 1674 4.035208 CAGTTTCGGCAGAAAACAACTACT 59.965 41.667 13.73 2.99 46.63 2.57
1867 1882 1.753368 TTGGCCCAAAAAGAAGCCCG 61.753 55.000 0.00 0.00 45.14 6.13
2098 2116 7.394816 TGATTAGAAAAAGAGGTCTAACCCTG 58.605 38.462 0.00 0.00 39.75 4.45
2255 2273 6.544197 TCTCAAACCAAAGCTGTGTACAAATA 59.456 34.615 2.51 0.00 0.00 1.40
2299 2317 9.851686 TTTAGAAGGCATCTATAAACACATCAT 57.148 29.630 0.00 0.00 40.32 2.45
2300 2318 9.851686 TTAGAAGGCATCTATAAACACATCATT 57.148 29.630 0.00 0.00 40.32 2.57
2486 2508 8.461249 AGTTTAACCTTACATAGATAGCTCGA 57.539 34.615 0.00 0.00 0.00 4.04
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
139 140 5.516768 GGAGAGAGGGTTTAGGGTTTGAAAT 60.517 44.000 0.00 0.00 0.00 2.17
534 541 2.643551 CATTTCTGCGGGGTTATGAGT 58.356 47.619 0.00 0.00 0.00 3.41
586 594 0.618458 TTTGGCGCTTGGTAGGATCT 59.382 50.000 7.64 0.00 0.00 2.75
616 624 1.533219 CATGCCTGCCCCACATCTA 59.467 57.895 0.00 0.00 0.00 1.98
655 663 1.734465 GACAGTGCAGTAGCCAATCAC 59.266 52.381 0.00 0.00 41.13 3.06
739 748 5.473162 CCAACTCTTAACATTGACATGTGGA 59.527 40.000 1.15 0.00 43.34 4.02
821 831 3.960102 GTCTGTCAGATGGAGAAGAGGAT 59.040 47.826 5.68 0.00 0.00 3.24
861 871 4.082517 GGAAAGAAACAGAGGAATTGCTCC 60.083 45.833 21.91 7.60 45.81 4.70
1060 1070 2.899900 GCCCAAAGTTCCCATTCTTCTT 59.100 45.455 0.00 0.00 0.00 2.52
1109 1119 0.343372 AGATCTAACCTGCCCCTCCA 59.657 55.000 0.00 0.00 0.00 3.86
1227 1237 7.118060 TGTAATCATCCATCCACTCAAAATGA 58.882 34.615 0.00 0.00 0.00 2.57
1346 1356 2.723746 GGTATTCCGGACGCGCTA 59.276 61.111 1.83 0.00 0.00 4.26
1374 1384 1.201647 TCCGTCTTCAGTTCGACATCC 59.798 52.381 0.00 0.00 0.00 3.51
1568 1581 4.023707 AGTTGCACTAAACAGAGTTGCATC 60.024 41.667 0.00 0.00 35.15 3.91
1848 1863 1.753368 CGGGCTTCTTTTTGGGCCAA 61.753 55.000 16.66 16.66 45.68 4.52
2219 2237 5.048434 GCTTTGGTTTGAGAGCTCTGTATTT 60.048 40.000 23.91 0.00 32.54 1.40
2486 2508 1.472480 GAGTTTGGTGTGTGTGTTGCT 59.528 47.619 0.00 0.00 0.00 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.