Multiple sequence alignment - TraesCS2A01G286400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G286400 chr2A 100.000 1616 0 0 649 2264 485967318 485968933 0.000000e+00 2985
1 TraesCS2A01G286400 chr2A 100.000 319 0 0 1 319 485966670 485966988 6.960000e-165 590
2 TraesCS2A01G286400 chr2A 98.750 320 3 1 1 319 485974791 485975110 3.260000e-158 568
3 TraesCS2A01G286400 chr5A 96.523 1553 53 1 712 2264 334649900 334648349 0.000000e+00 2567
4 TraesCS2A01G286400 chr5A 93.195 338 3 7 1 319 334650604 334650268 1.570000e-131 479
5 TraesCS2A01G286400 chr5A 92.012 338 8 6 1 319 334642273 334641936 7.370000e-125 457
6 TraesCS2A01G286400 chr7A 97.045 1489 44 0 776 2264 485698119 485696631 0.000000e+00 2507
7 TraesCS2A01G286400 chr7A 96.578 1198 40 1 763 1960 485690014 485688818 0.000000e+00 1984
8 TraesCS2A01G286400 chr7A 92.604 338 5 6 1 319 485690821 485690485 3.400000e-128 468
9 TraesCS2A01G286400 chr7A 92.604 338 6 6 1 319 485698913 485698576 3.400000e-128 468
10 TraesCS2A01G286400 chr3A 95.185 1350 60 3 705 2054 174791300 174789956 0.000000e+00 2128
11 TraesCS2A01G286400 chr3A 92.308 338 7 8 1 319 174769139 174768802 1.580000e-126 462
12 TraesCS2A01G286400 chr3A 91.716 338 8 7 1 319 174792059 174791723 3.430000e-123 451
13 TraesCS2A01G286400 chr3B 95.616 1323 52 5 681 2000 234961690 234960371 0.000000e+00 2117
14 TraesCS2A01G286400 chr3B 93.546 1317 75 8 649 1962 116638044 116636735 0.000000e+00 1953
15 TraesCS2A01G286400 chr3B 94.958 1190 54 5 676 1863 116648291 116647106 0.000000e+00 1860
16 TraesCS2A01G286400 chr3B 95.431 1138 46 5 729 1863 116649452 116648318 0.000000e+00 1808
17 TraesCS2A01G286400 chr3B 87.360 712 85 4 1556 2264 725497044 725497753 0.000000e+00 811
18 TraesCS2A01G286400 chr3B 88.553 629 66 6 1638 2263 610659576 610658951 0.000000e+00 758
19 TraesCS2A01G286400 chr3B 85.578 735 91 14 1538 2264 701333856 701333129 0.000000e+00 756
20 TraesCS2A01G286400 chr3B 97.561 164 3 1 157 319 116638367 116638204 1.710000e-71 279
21 TraesCS2A01G286400 chr3B 97.561 164 3 1 157 319 116649995 116649832 1.710000e-71 279
22 TraesCS2A01G286400 chr3B 97.561 164 3 1 157 319 234953960 234953797 1.710000e-71 279
23 TraesCS2A01G286400 chr7B 93.888 1227 63 7 742 1960 388612788 388614010 0.000000e+00 1840
24 TraesCS2A01G286400 chr7B 97.561 164 3 1 157 319 388603180 388603343 1.710000e-71 279
25 TraesCS2A01G286400 chr7B 97.561 164 3 1 157 319 388611284 388611447 1.710000e-71 279
26 TraesCS2A01G286400 chr1A 90.448 335 12 7 4 319 39076472 39076139 7.480000e-115 424
27 TraesCS2A01G286400 chr1A 89.552 335 15 9 4 319 39063710 39063377 7.530000e-110 407
28 TraesCS2A01G286400 chrUn 97.561 164 3 1 157 319 416796441 416796604 1.710000e-71 279
29 TraesCS2A01G286400 chr1B 97.561 164 3 1 157 319 190294987 190294824 1.710000e-71 279


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G286400 chr2A 485966670 485968933 2263 False 1787.500000 2985 100.000000 1 2264 2 chr2A.!!$F2 2263
1 TraesCS2A01G286400 chr5A 334648349 334650604 2255 True 1523.000000 2567 94.859000 1 2264 2 chr5A.!!$R2 2263
2 TraesCS2A01G286400 chr7A 485696631 485698913 2282 True 1487.500000 2507 94.824500 1 2264 2 chr7A.!!$R2 2263
3 TraesCS2A01G286400 chr7A 485688818 485690821 2003 True 1226.000000 1984 94.591000 1 1960 2 chr7A.!!$R1 1959
4 TraesCS2A01G286400 chr3A 174789956 174792059 2103 True 1289.500000 2128 93.450500 1 2054 2 chr3A.!!$R2 2053
5 TraesCS2A01G286400 chr3B 234960371 234961690 1319 True 2117.000000 2117 95.616000 681 2000 1 chr3B.!!$R2 1319
6 TraesCS2A01G286400 chr3B 116647106 116649995 2889 True 1315.666667 1860 95.983333 157 1863 3 chr3B.!!$R6 1706
7 TraesCS2A01G286400 chr3B 116636735 116638367 1632 True 1116.000000 1953 95.553500 157 1962 2 chr3B.!!$R5 1805
8 TraesCS2A01G286400 chr3B 725497044 725497753 709 False 811.000000 811 87.360000 1556 2264 1 chr3B.!!$F1 708
9 TraesCS2A01G286400 chr3B 610658951 610659576 625 True 758.000000 758 88.553000 1638 2263 1 chr3B.!!$R3 625
10 TraesCS2A01G286400 chr3B 701333129 701333856 727 True 756.000000 756 85.578000 1538 2264 1 chr3B.!!$R4 726
11 TraesCS2A01G286400 chr7B 388611284 388614010 2726 False 1059.500000 1840 95.724500 157 1960 2 chr7B.!!$F2 1803

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
144 145 0.413434 TGACAGATGGGTCCAGAGGA 59.587 55.000 0.00 0.00 36.97 3.71 F
309 329 1.210967 TGTTTATCTAAGGGGCCCACG 59.789 52.381 27.72 12.55 0.00 4.94 F
697 1907 1.454663 GGGGAGGAGAAGCAATGGC 60.455 63.158 0.00 0.00 41.61 4.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1018 2426 1.049289 GGCTTCCCCGAGACCACTAT 61.049 60.000 0.0 0.0 0.0 2.12 R
1176 2584 1.372997 GAGCCGCAACGAGAAGACA 60.373 57.895 0.0 0.0 0.0 3.41 R
1515 2923 8.467598 AGGAGTTAGACAAAAGAAAAGGAAAAC 58.532 33.333 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
144 145 0.413434 TGACAGATGGGTCCAGAGGA 59.587 55.000 0.00 0.00 36.97 3.71
309 329 1.210967 TGTTTATCTAAGGGGCCCACG 59.789 52.381 27.72 12.55 0.00 4.94
697 1907 1.454663 GGGGAGGAGAAGCAATGGC 60.455 63.158 0.00 0.00 41.61 4.40
740 1950 4.069232 CACGCGAGCAGGGGAGAA 62.069 66.667 15.93 0.00 37.07 2.87
993 2401 3.082055 GAAGAGGGGGTCGGGGAC 61.082 72.222 0.00 0.00 0.00 4.46
1018 2426 1.456296 GATGCTCACATTGGTGCTCA 58.544 50.000 0.00 0.00 44.87 4.26
1124 2532 3.453679 GGCGAGGCTCGGAACTCT 61.454 66.667 35.03 0.00 40.84 3.24
1127 2535 2.973899 GAGGCTCGGAACTCTGCA 59.026 61.111 0.00 0.00 0.00 4.41
1515 2923 2.295909 TGTTTTCTTTTGCTGATCGGGG 59.704 45.455 3.14 0.00 0.00 5.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
144 145 1.149101 ATCTGTTGGGTCAACTGGGT 58.851 50.000 14.49 4.99 43.85 4.51
683 1892 1.222936 CTCGGCCATTGCTTCTCCT 59.777 57.895 2.24 0.00 37.74 3.69
879 2285 3.449227 CGCCTCTGACTACGCCCA 61.449 66.667 0.00 0.00 0.00 5.36
885 2291 2.829003 CCGCCTCGCCTCTGACTA 60.829 66.667 0.00 0.00 0.00 2.59
993 2401 1.431488 CCAATGTGAGCATCCGGTCG 61.431 60.000 0.00 0.00 42.80 4.79
1018 2426 1.049289 GGCTTCCCCGAGACCACTAT 61.049 60.000 0.00 0.00 0.00 2.12
1124 2532 4.149598 TGAGTAGAAGGAGTTGTACTGCA 58.850 43.478 0.10 0.00 41.60 4.41
1127 2535 4.767928 CACCTGAGTAGAAGGAGTTGTACT 59.232 45.833 0.00 0.00 43.63 2.73
1176 2584 1.372997 GAGCCGCAACGAGAAGACA 60.373 57.895 0.00 0.00 0.00 3.41
1210 2618 2.709475 GCCGCCATCATTGTCGTC 59.291 61.111 0.00 0.00 0.00 4.20
1246 2654 2.287915 CCTCTTAATTTCGTCCATGCCG 59.712 50.000 0.00 0.00 0.00 5.69
1515 2923 8.467598 AGGAGTTAGACAAAAGAAAAGGAAAAC 58.532 33.333 0.00 0.00 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.