Multiple sequence alignment - TraesCS2A01G260900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G260900 chr2A 100.000 3005 0 0 1 3005 410884155 410881151 0.000000e+00 5550.0
1 TraesCS2A01G260900 chr2A 97.624 1894 38 1 1089 2975 649697506 649699399 0.000000e+00 3241.0
2 TraesCS2A01G260900 chr2A 90.662 1103 79 18 1 1088 94257906 94258999 0.000000e+00 1445.0
3 TraesCS2A01G260900 chr2A 90.576 1093 87 12 1 1082 722173432 722172345 0.000000e+00 1434.0
4 TraesCS2A01G260900 chr2A 90.385 1092 92 11 1 1082 722181239 722180151 0.000000e+00 1423.0
5 TraesCS2A01G260900 chr2A 90.134 1044 83 18 56 1083 353069580 353068541 0.000000e+00 1339.0
6 TraesCS2A01G260900 chr2A 89.933 1043 87 16 56 1083 353077591 353076552 0.000000e+00 1328.0
7 TraesCS2A01G260900 chr2A 94.299 649 34 2 1 647 94265597 94266244 0.000000e+00 990.0
8 TraesCS2A01G260900 chr2A 85.252 834 87 28 286 1098 5331865 5331047 0.000000e+00 826.0
9 TraesCS2A01G260900 chr2A 83.461 393 62 2 1467 1858 191635834 191635444 2.200000e-96 363.0
10 TraesCS2A01G260900 chr2A 100.000 44 0 0 2962 3005 649699400 649699443 6.900000e-12 82.4
11 TraesCS2A01G260900 chr6A 97.600 1917 42 2 1089 3005 44970814 44972726 0.000000e+00 3282.0
12 TraesCS2A01G260900 chr6A 93.488 691 39 6 402 1089 180236204 180235517 0.000000e+00 1022.0
13 TraesCS2A01G260900 chr3A 95.868 1089 43 2 1 1088 221531249 221530162 0.000000e+00 1760.0
14 TraesCS2A01G260900 chr3A 88.571 700 64 14 405 1093 401414362 401413668 0.000000e+00 835.0
15 TraesCS2A01G260900 chr3A 94.186 86 2 3 1 84 592976413 592976497 8.740000e-26 128.0
16 TraesCS2A01G260900 chr7A 95.247 1094 45 5 1 1088 257172011 257173103 0.000000e+00 1725.0
17 TraesCS2A01G260900 chr7A 92.319 690 44 8 402 1088 395992532 395993215 0.000000e+00 972.0
18 TraesCS2A01G260900 chr7A 90.145 690 53 8 402 1088 395984670 395985347 0.000000e+00 883.0
19 TraesCS2A01G260900 chr7A 94.186 86 2 3 1 84 431155230 431155146 8.740000e-26 128.0
20 TraesCS2A01G260900 chr7A 94.186 86 2 3 1 84 431163000 431162916 8.740000e-26 128.0
21 TraesCS2A01G260900 chr5A 90.202 1041 85 16 56 1083 260617990 260619026 0.000000e+00 1341.0
22 TraesCS2A01G260900 chr1A 89.359 686 59 8 408 1083 339870798 339870117 0.000000e+00 850.0
23 TraesCS2A01G260900 chr2D 90.184 326 32 0 2680 3005 106440540 106440215 2.770000e-115 425.0
24 TraesCS2A01G260900 chr2B 79.022 491 93 7 1466 1949 72932852 72932365 8.030000e-86 327.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G260900 chr2A 410881151 410884155 3004 True 5550.0 5550 100.000 1 3005 1 chr2A.!!$R5 3004
1 TraesCS2A01G260900 chr2A 649697506 649699443 1937 False 1661.7 3241 98.812 1089 3005 2 chr2A.!!$F3 1916
2 TraesCS2A01G260900 chr2A 94257906 94258999 1093 False 1445.0 1445 90.662 1 1088 1 chr2A.!!$F1 1087
3 TraesCS2A01G260900 chr2A 722172345 722173432 1087 True 1434.0 1434 90.576 1 1082 1 chr2A.!!$R6 1081
4 TraesCS2A01G260900 chr2A 722180151 722181239 1088 True 1423.0 1423 90.385 1 1082 1 chr2A.!!$R7 1081
5 TraesCS2A01G260900 chr2A 353068541 353069580 1039 True 1339.0 1339 90.134 56 1083 1 chr2A.!!$R3 1027
6 TraesCS2A01G260900 chr2A 353076552 353077591 1039 True 1328.0 1328 89.933 56 1083 1 chr2A.!!$R4 1027
7 TraesCS2A01G260900 chr2A 94265597 94266244 647 False 990.0 990 94.299 1 647 1 chr2A.!!$F2 646
8 TraesCS2A01G260900 chr2A 5331047 5331865 818 True 826.0 826 85.252 286 1098 1 chr2A.!!$R1 812
9 TraesCS2A01G260900 chr6A 44970814 44972726 1912 False 3282.0 3282 97.600 1089 3005 1 chr6A.!!$F1 1916
10 TraesCS2A01G260900 chr6A 180235517 180236204 687 True 1022.0 1022 93.488 402 1089 1 chr6A.!!$R1 687
11 TraesCS2A01G260900 chr3A 221530162 221531249 1087 True 1760.0 1760 95.868 1 1088 1 chr3A.!!$R1 1087
12 TraesCS2A01G260900 chr3A 401413668 401414362 694 True 835.0 835 88.571 405 1093 1 chr3A.!!$R2 688
13 TraesCS2A01G260900 chr7A 257172011 257173103 1092 False 1725.0 1725 95.247 1 1088 1 chr7A.!!$F1 1087
14 TraesCS2A01G260900 chr7A 395992532 395993215 683 False 972.0 972 92.319 402 1088 1 chr7A.!!$F3 686
15 TraesCS2A01G260900 chr7A 395984670 395985347 677 False 883.0 883 90.145 402 1088 1 chr7A.!!$F2 686
16 TraesCS2A01G260900 chr5A 260617990 260619026 1036 False 1341.0 1341 90.202 56 1083 1 chr5A.!!$F1 1027
17 TraesCS2A01G260900 chr1A 339870117 339870798 681 True 850.0 850 89.359 408 1083 1 chr1A.!!$R1 675

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
698 731 0.896940 AGAGACCCGGCGACTGTTTA 60.897 55.0 9.3 0.0 0.00 2.01 F
1034 1080 0.961019 ACGCAAGCAAATGACATGGT 59.039 45.0 0.0 0.0 45.62 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1576 1622 0.712380 ATTGGGAGGGCCTTGATGTT 59.288 50.000 7.89 0.0 0.0 2.71 R
2813 2866 1.066587 GAGATCCAAGAGCGACCGG 59.933 63.158 0.00 0.0 0.0 5.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
613 632 2.187946 GGGGCTGTGATCTGACGG 59.812 66.667 0.00 0.00 0.00 4.79
698 731 0.896940 AGAGACCCGGCGACTGTTTA 60.897 55.000 9.30 0.00 0.00 2.01
915 951 2.237066 CGCGTGCAAGTGTGTCTGA 61.237 57.895 4.93 0.00 0.00 3.27
1034 1080 0.961019 ACGCAAGCAAATGACATGGT 59.039 45.000 0.00 0.00 45.62 3.55
1253 1299 2.903357 CTCCATCCGAGTGTGGGG 59.097 66.667 0.00 0.00 36.15 4.96
1255 1301 2.687200 CCATCCGAGTGTGGGGGA 60.687 66.667 0.00 0.00 0.00 4.81
1576 1622 0.039180 TACAGCGGTCTTCTCCTCCA 59.961 55.000 0.00 0.00 0.00 3.86
1805 1851 3.011821 TCAGTGGGAGAGACCTCTAACAT 59.988 47.826 0.00 0.00 40.61 2.71
1898 1951 3.521529 CTGCTAGGAATCCCGCGGG 62.522 68.421 39.13 39.13 37.58 6.13
2002 2055 1.750399 GCTGTCATTCCCACGGCAT 60.750 57.895 0.00 0.00 44.37 4.40
2319 2372 3.369147 CAGTGAGAAGCATTGGAGTAACG 59.631 47.826 0.00 0.00 31.17 3.18
2321 2374 3.994392 GTGAGAAGCATTGGAGTAACGAA 59.006 43.478 0.00 0.00 0.00 3.85
2455 2508 0.331616 GGAAGGGTTGGTGCCTACAT 59.668 55.000 5.30 0.00 0.00 2.29
2674 2727 2.064581 GGGGAGGAGAAAGGCGCTA 61.065 63.158 7.64 0.00 0.00 4.26
2813 2866 1.446966 GAACTCTCAGGCGGCAGTC 60.447 63.158 13.08 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 230 1.413767 CGAGTGATTCGCGTCCAAGG 61.414 60.000 5.77 0.0 43.22 3.61
605 624 3.603965 ACCTAATCTCTCCCGTCAGAT 57.396 47.619 0.00 0.0 0.00 2.90
698 731 2.737932 CGGACGTTTTCGGTCTCCGT 62.738 60.000 8.03 0.0 46.72 4.69
915 951 0.748450 TCCGTTGTCCGTTCTGAGTT 59.252 50.000 0.00 0.0 33.66 3.01
1034 1080 4.020928 TCCTCCAGTTATTCGCTGTTGTTA 60.021 41.667 0.00 0.0 32.41 2.41
1169 1215 4.693532 TGACTCCGTCATTGTGGC 57.306 55.556 0.00 0.0 37.67 5.01
1253 1299 1.534203 GGGAGCCCCTGAATCTTCC 59.466 63.158 3.16 0.0 41.34 3.46
1255 1301 0.326238 TACGGGAGCCCCTGAATCTT 60.326 55.000 0.00 0.0 42.67 2.40
1484 1530 8.017946 GCAGTCCACAACAAAAACAAAAATTTA 58.982 29.630 0.00 0.0 0.00 1.40
1488 1534 5.049818 CAGCAGTCCACAACAAAAACAAAAA 60.050 36.000 0.00 0.0 0.00 1.94
1491 1537 3.583806 CAGCAGTCCACAACAAAAACAA 58.416 40.909 0.00 0.0 0.00 2.83
1576 1622 0.712380 ATTGGGAGGGCCTTGATGTT 59.288 50.000 7.89 0.0 0.00 2.71
1648 1694 5.656416 ACATTCCTTCAAACTCCAAAGAACA 59.344 36.000 0.00 0.0 0.00 3.18
1783 1829 2.378886 TGTTAGAGGTCTCTCCCACTGA 59.621 50.000 3.49 0.0 40.83 3.41
1938 1991 2.260434 GCTTCAGTACGCCCACGA 59.740 61.111 0.00 0.0 43.93 4.35
2077 2130 3.241530 AGCAGTGGCACTTCCCGA 61.242 61.111 19.43 0.0 44.61 5.14
2455 2508 5.514274 AAAGAGAAAACCAAATCGCTTCA 57.486 34.783 0.00 0.0 35.12 3.02
2674 2727 1.376649 ATCCTGCTTTGTCCTTCCCT 58.623 50.000 0.00 0.0 0.00 4.20
2813 2866 1.066587 GAGATCCAAGAGCGACCGG 59.933 63.158 0.00 0.0 0.00 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.