Multiple sequence alignment - TraesCS2A01G259100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G259100 chr2A 100.000 2716 0 0 1 2716 406995944 406998659 0.000000e+00 5016.0
1 TraesCS2A01G259100 chr2A 99.595 2715 9 1 1 2715 407124443 407127155 0.000000e+00 4951.0
2 TraesCS2A01G259100 chr2A 86.816 895 98 17 845 1730 73183551 73182668 0.000000e+00 981.0
3 TraesCS2A01G259100 chr2A 85.638 940 91 16 842 1778 73179956 73179058 0.000000e+00 948.0
4 TraesCS2A01G259100 chr2A 88.705 726 68 8 996 1717 406964297 406963582 0.000000e+00 874.0
5 TraesCS2A01G259100 chr2A 88.705 726 68 8 996 1717 407092473 407091758 0.000000e+00 874.0
6 TraesCS2A01G259100 chr2A 85.068 663 94 5 1 660 203229515 203230175 0.000000e+00 671.0
7 TraesCS2A01G259100 chr2A 100.000 41 0 0 1772 1812 406997687 406997727 2.900000e-10 76.8
8 TraesCS2A01G259100 chr2A 100.000 41 0 0 1744 1784 406997715 406997755 2.900000e-10 76.8
9 TraesCS2A01G259100 chr2A 100.000 41 0 0 1772 1812 407126184 407126224 2.900000e-10 76.8
10 TraesCS2A01G259100 chr2A 100.000 41 0 0 1744 1784 407126212 407126252 2.900000e-10 76.8
11 TraesCS2A01G259100 chr2D 95.446 1054 37 7 733 1784 323517319 323516275 0.000000e+00 1670.0
12 TraesCS2A01G259100 chr2D 85.409 1124 108 33 669 1764 73820435 73819340 0.000000e+00 1116.0
13 TraesCS2A01G259100 chr2D 87.566 941 90 13 842 1778 73592304 73591387 0.000000e+00 1064.0
14 TraesCS2A01G259100 chr2D 89.009 737 69 8 983 1717 323561355 323562081 0.000000e+00 902.0
15 TraesCS2A01G259100 chr2D 83.652 679 104 4 1 675 323520938 323520263 1.370000e-177 632.0
16 TraesCS2A01G259100 chr2D 87.914 513 52 3 1875 2387 323516244 323515742 1.800000e-166 595.0
17 TraesCS2A01G259100 chr2D 94.444 72 4 0 671 742 323517566 323517495 7.950000e-21 111.0
18 TraesCS2A01G259100 chr2B 84.904 1146 111 39 666 1773 111669755 111668634 0.000000e+00 1101.0
19 TraesCS2A01G259100 chr2B 89.540 631 47 7 669 1298 391496143 391495531 0.000000e+00 782.0
20 TraesCS2A01G259100 chr2B 78.613 519 72 21 1876 2382 391492941 391492450 9.450000e-80 307.0
21 TraesCS2A01G259100 chr1B 85.119 672 95 5 1 669 339360874 339361543 0.000000e+00 682.0
22 TraesCS2A01G259100 chr1B 84.347 658 97 4 1 656 434563298 434562645 8.200000e-180 640.0
23 TraesCS2A01G259100 chr4D 84.352 671 101 4 1 669 309942572 309943240 0.000000e+00 654.0
24 TraesCS2A01G259100 chr1D 84.094 679 100 8 1 675 447464811 447464137 0.000000e+00 649.0
25 TraesCS2A01G259100 chr1D 83.929 672 102 6 1 669 417913498 417912830 2.950000e-179 638.0
26 TraesCS2A01G259100 chr3A 83.804 673 102 7 1 669 59949384 59950053 1.370000e-177 632.0
27 TraesCS2A01G259100 chr6A 99.088 329 3 0 2387 2715 169321079 169321407 2.330000e-165 592.0
28 TraesCS2A01G259100 chr6A 98.780 328 4 0 2388 2715 96001469 96001142 3.900000e-163 584.0
29 TraesCS2A01G259100 chr6A 98.780 328 4 0 2388 2715 415911780 415912107 3.900000e-163 584.0
30 TraesCS2A01G259100 chr1A 99.088 329 3 0 2387 2715 277182535 277182863 2.330000e-165 592.0
31 TraesCS2A01G259100 chr1A 99.088 329 3 0 2387 2715 277190632 277190960 2.330000e-165 592.0
32 TraesCS2A01G259100 chr1A 98.784 329 4 0 2387 2715 273340417 273340089 1.080000e-163 586.0
33 TraesCS2A01G259100 chr4A 98.788 330 3 1 2387 2715 13085331 13085002 1.080000e-163 586.0
34 TraesCS2A01G259100 chr4A 98.784 329 4 0 2387 2715 577574860 577574532 1.080000e-163 586.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G259100 chr2A 406995944 406998659 2715 False 1723.200000 5016 100.0000 1 2716 3 chr2A.!!$F2 2715
1 TraesCS2A01G259100 chr2A 407124443 407127155 2712 False 1701.533333 4951 99.8650 1 2715 3 chr2A.!!$F3 2714
2 TraesCS2A01G259100 chr2A 73179058 73183551 4493 True 964.500000 981 86.2270 842 1778 2 chr2A.!!$R3 936
3 TraesCS2A01G259100 chr2A 406963582 406964297 715 True 874.000000 874 88.7050 996 1717 1 chr2A.!!$R1 721
4 TraesCS2A01G259100 chr2A 407091758 407092473 715 True 874.000000 874 88.7050 996 1717 1 chr2A.!!$R2 721
5 TraesCS2A01G259100 chr2A 203229515 203230175 660 False 671.000000 671 85.0680 1 660 1 chr2A.!!$F1 659
6 TraesCS2A01G259100 chr2D 73819340 73820435 1095 True 1116.000000 1116 85.4090 669 1764 1 chr2D.!!$R2 1095
7 TraesCS2A01G259100 chr2D 73591387 73592304 917 True 1064.000000 1064 87.5660 842 1778 1 chr2D.!!$R1 936
8 TraesCS2A01G259100 chr2D 323561355 323562081 726 False 902.000000 902 89.0090 983 1717 1 chr2D.!!$F1 734
9 TraesCS2A01G259100 chr2D 323515742 323520938 5196 True 752.000000 1670 90.3640 1 2387 4 chr2D.!!$R3 2386
10 TraesCS2A01G259100 chr2B 111668634 111669755 1121 True 1101.000000 1101 84.9040 666 1773 1 chr2B.!!$R1 1107
11 TraesCS2A01G259100 chr2B 391492450 391496143 3693 True 544.500000 782 84.0765 669 2382 2 chr2B.!!$R2 1713
12 TraesCS2A01G259100 chr1B 339360874 339361543 669 False 682.000000 682 85.1190 1 669 1 chr1B.!!$F1 668
13 TraesCS2A01G259100 chr1B 434562645 434563298 653 True 640.000000 640 84.3470 1 656 1 chr1B.!!$R1 655
14 TraesCS2A01G259100 chr4D 309942572 309943240 668 False 654.000000 654 84.3520 1 669 1 chr4D.!!$F1 668
15 TraesCS2A01G259100 chr1D 447464137 447464811 674 True 649.000000 649 84.0940 1 675 1 chr1D.!!$R2 674
16 TraesCS2A01G259100 chr1D 417912830 417913498 668 True 638.000000 638 83.9290 1 669 1 chr1D.!!$R1 668
17 TraesCS2A01G259100 chr3A 59949384 59950053 669 False 632.000000 632 83.8040 1 669 1 chr3A.!!$F1 668

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
567 573 3.307059 GGATCGATGGATTAAGGAGGTGG 60.307 52.174 0.54 0.0 31.51 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2458 11089 7.097192 TGTAGAGTTGTGTTGTGATATCTTCC 58.903 38.462 3.98 0.0 0.0 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
314 320 7.418254 GGGGCATTATCTTTCAAGACATTCATT 60.418 37.037 0.00 0.0 37.98 2.57
567 573 3.307059 GGATCGATGGATTAAGGAGGTGG 60.307 52.174 0.54 0.0 31.51 4.61
2313 10937 2.165845 CGTCGTCATCCTTCCCTAAGTT 59.834 50.000 0.00 0.0 0.00 2.66
2458 11089 1.186200 TCAAGATCAGGGACTCACGG 58.814 55.000 0.00 0.0 34.60 4.94
2715 11346 3.690280 TCGTCAGCGGGCATCACA 61.690 61.111 0.00 0.0 38.89 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
314 320 1.206811 TCCACATGTCCATCCAGCCA 61.207 55.000 0.00 0.0 0.0 4.75
567 573 3.799755 CGCACGCTAAAGGGCCAC 61.800 66.667 6.18 0.0 37.2 5.01
2458 11089 7.097192 TGTAGAGTTGTGTTGTGATATCTTCC 58.903 38.462 3.98 0.0 0.0 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.