Multiple sequence alignment - TraesCS2A01G249200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G249200 chr2A 100.000 3981 0 0 1 3981 374483213 374487193 0.000000e+00 7352
1 TraesCS2A01G249200 chr2A 98.670 3985 47 5 1 3981 628648676 628644694 0.000000e+00 7060
2 TraesCS2A01G249200 chr2A 98.370 3988 55 8 1 3981 628569340 628573324 0.000000e+00 6996
3 TraesCS2A01G249200 chr2A 98.319 3985 57 6 1 3981 161526406 161530384 0.000000e+00 6979
4 TraesCS2A01G249200 chr2A 93.909 197 11 1 7 202 305828675 305828479 3.010000e-76 296
5 TraesCS2A01G249200 chr2A 92.500 200 12 2 7 203 756945563 756945364 2.340000e-72 283
6 TraesCS2A01G249200 chr1A 98.595 3987 50 5 1 3981 409608768 409612754 0.000000e+00 7047
7 TraesCS2A01G249200 chr1B 98.165 3978 70 3 7 3981 530764582 530760605 0.000000e+00 6938
8 TraesCS2A01G249200 chr1B 98.118 3985 67 6 1 3981 95491577 95495557 0.000000e+00 6937
9 TraesCS2A01G249200 chr2B 97.740 3982 79 9 7 3981 424685476 424681499 0.000000e+00 6844
10 TraesCS2A01G249200 chr7D 97.403 3235 72 4 755 3981 474677238 474680468 0.000000e+00 5498
11 TraesCS2A01G249200 chr5A 95.904 2905 109 8 226 3127 272284484 272287381 0.000000e+00 4697


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G249200 chr2A 374483213 374487193 3980 False 7352 7352 100.000 1 3981 1 chr2A.!!$F2 3980
1 TraesCS2A01G249200 chr2A 628644694 628648676 3982 True 7060 7060 98.670 1 3981 1 chr2A.!!$R2 3980
2 TraesCS2A01G249200 chr2A 628569340 628573324 3984 False 6996 6996 98.370 1 3981 1 chr2A.!!$F3 3980
3 TraesCS2A01G249200 chr2A 161526406 161530384 3978 False 6979 6979 98.319 1 3981 1 chr2A.!!$F1 3980
4 TraesCS2A01G249200 chr1A 409608768 409612754 3986 False 7047 7047 98.595 1 3981 1 chr1A.!!$F1 3980
5 TraesCS2A01G249200 chr1B 530760605 530764582 3977 True 6938 6938 98.165 7 3981 1 chr1B.!!$R1 3974
6 TraesCS2A01G249200 chr1B 95491577 95495557 3980 False 6937 6937 98.118 1 3981 1 chr1B.!!$F1 3980
7 TraesCS2A01G249200 chr2B 424681499 424685476 3977 True 6844 6844 97.740 7 3981 1 chr2B.!!$R1 3974
8 TraesCS2A01G249200 chr7D 474677238 474680468 3230 False 5498 5498 97.403 755 3981 1 chr7D.!!$F1 3226
9 TraesCS2A01G249200 chr5A 272284484 272287381 2897 False 4697 4697 95.904 226 3127 1 chr5A.!!$F1 2901

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
501 505 0.234884 CTCGAAGGGCACGTCAAAAC 59.765 55.000 2.03 0.0 0.00 2.43 F
507 512 2.527867 GGCACGTCAAAACCGTCGT 61.528 57.895 0.00 0.0 36.17 4.34 F
1372 1378 1.070134 ACCAAGTCAAGCTACGAGCAA 59.930 47.619 9.09 0.0 45.56 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1367 1373 1.366111 TAAGATTGCCGCCGTTGCTC 61.366 55.000 0.00 0.0 34.43 4.26 R
1712 1723 1.539280 GCTCTATCCCTTTCGACAGCC 60.539 57.143 0.00 0.0 0.00 4.85 R
3051 3064 0.168348 CTTTACAGCAGCAGCAGCAG 59.832 55.000 12.92 6.6 45.49 4.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
501 505 0.234884 CTCGAAGGGCACGTCAAAAC 59.765 55.000 2.03 0.00 0.00 2.43
507 512 2.527867 GGCACGTCAAAACCGTCGT 61.528 57.895 0.00 0.00 36.17 4.34
850 856 3.129287 GCCAACTTTGATCCACATCGATT 59.871 43.478 0.00 0.00 0.00 3.34
944 950 6.463360 GGACACATGTTCCCATAACAATTTT 58.537 36.000 13.20 0.00 33.42 1.82
1367 1373 3.305398 AGAGAACCAAGTCAAGCTACG 57.695 47.619 0.00 0.00 0.00 3.51
1372 1378 1.070134 ACCAAGTCAAGCTACGAGCAA 59.930 47.619 9.09 0.00 45.56 3.91
1540 1547 4.693283 CGACAACCTTAGAGATGCCATTA 58.307 43.478 0.00 0.00 0.00 1.90
2513 2525 3.446161 ACATTGCTCAACCCAATCAGATG 59.554 43.478 0.00 0.00 30.90 2.90
2622 2634 2.973945 AGATGTTGAGGAGGTTTACGC 58.026 47.619 0.00 0.00 0.00 4.42
2841 2854 7.661437 TGAGTACTCTATCAAAAACTGCATTGT 59.339 33.333 23.01 0.00 0.00 2.71
2950 2963 4.459089 GCCAGACCGGAGACTGCC 62.459 72.222 9.46 0.42 36.56 4.85
2974 2987 3.920231 ATGTGGCTGAGAGCTGAAATA 57.080 42.857 0.00 0.00 41.99 1.40
3051 3064 3.056607 AGCCATTTAGTCCATGTTGTTGC 60.057 43.478 0.00 0.00 0.00 4.17
3840 3859 6.656270 TCTGTGTCATTACTGCATGAGAATTT 59.344 34.615 0.00 0.00 33.69 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
501 505 2.572191 TCCTAAATGCTACACGACGG 57.428 50.000 0.00 0.0 0.00 4.79
507 512 2.224281 CGGCTCCATCCTAAATGCTACA 60.224 50.000 0.00 0.0 0.00 2.74
658 663 1.404035 GCTGTGACCAAACCGAACTTT 59.596 47.619 0.00 0.0 0.00 2.66
850 856 8.534954 AGCACCTATAACATGAAGAGTAAGTA 57.465 34.615 0.00 0.0 0.00 2.24
944 950 0.398696 TGGTGCGGCTTTTTCTCCTA 59.601 50.000 0.00 0.0 0.00 2.94
1367 1373 1.366111 TAAGATTGCCGCCGTTGCTC 61.366 55.000 0.00 0.0 34.43 4.26
1372 1378 1.937899 GTTATGTAAGATTGCCGCCGT 59.062 47.619 0.00 0.0 0.00 5.68
1540 1547 2.885135 TCAGCCCACATTTGATGAGT 57.115 45.000 0.00 0.0 0.00 3.41
1712 1723 1.539280 GCTCTATCCCTTTCGACAGCC 60.539 57.143 0.00 0.0 0.00 4.85
2513 2525 1.754226 AGCTCCTCCAAGATTCTCGAC 59.246 52.381 0.00 0.0 0.00 4.20
2622 2634 3.443037 TCCACAACAATGTTTTCTTGCG 58.557 40.909 0.00 0.0 37.82 4.85
2841 2854 5.048504 GTGATCTCCATTGTTTTCAGCAGAA 60.049 40.000 0.00 0.0 0.00 3.02
2950 2963 1.483827 TCAGCTCTCAGCCACATAAGG 59.516 52.381 0.00 0.0 43.77 2.69
3051 3064 0.168348 CTTTACAGCAGCAGCAGCAG 59.832 55.000 12.92 6.6 45.49 4.24
3190 3207 3.551485 TGTGTCGATACATCAAGCAATCG 59.449 43.478 11.30 0.0 41.89 3.34
3606 3625 3.238441 GCTACAGTCAGTCGTTTCAGAG 58.762 50.000 0.00 0.0 0.00 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.