Multiple sequence alignment - TraesCS2A01G242700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G242700 chr2A 100.000 5218 0 0 1 5218 337858643 337863860 0.000000e+00 9636.0
1 TraesCS2A01G242700 chr2A 99.118 5218 31 4 2 5218 337718851 337724054 0.000000e+00 9367.0
2 TraesCS2A01G242700 chr2A 98.296 2054 31 3 2 2052 337856820 337854768 0.000000e+00 3596.0
3 TraesCS2A01G242700 chr2A 97.955 2054 33 3 2 2052 337717035 337714988 0.000000e+00 3552.0
4 TraesCS2A01G242700 chr7B 98.678 5221 64 5 2 5218 32024685 32019466 0.000000e+00 9254.0
5 TraesCS2A01G242700 chr7B 98.106 1056 19 1 992 2046 32024969 32026024 0.000000e+00 1838.0
6 TraesCS2A01G242700 chr7B 92.784 97 7 0 4782 4878 650237803 650237707 1.960000e-29 141.0
7 TraesCS2A01G242700 chr3B 93.891 4109 160 32 396 4440 580029554 580033635 0.000000e+00 6113.0
8 TraesCS2A01G242700 chr3B 92.276 246 14 2 2 247 580029305 580029545 1.390000e-90 344.0
9 TraesCS2A01G242700 chr3B 98.925 93 1 0 245 337 69267352 69267260 3.230000e-37 167.0
10 TraesCS2A01G242700 chr3B 92.632 95 7 0 4768 4862 64303429 64303523 2.530000e-28 137.0
11 TraesCS2A01G242700 chr3B 91.837 98 7 1 4766 4862 64322104 64322007 9.110000e-28 135.0
12 TraesCS2A01G242700 chr3B 87.179 78 6 2 4922 4995 693335986 693335909 9.310000e-13 86.1
13 TraesCS2A01G242700 chr3A 91.862 2003 108 21 2272 4249 583698392 583700364 0.000000e+00 2745.0
14 TraesCS2A01G242700 chr3A 90.563 1155 66 18 388 1517 583696496 583697632 0.000000e+00 1489.0
15 TraesCS2A01G242700 chr3A 94.160 702 36 4 1542 2242 583697625 583698322 0.000000e+00 1064.0
16 TraesCS2A01G242700 chr3A 96.341 164 6 0 2 165 583696163 583696326 2.390000e-68 270.0
17 TraesCS2A01G242700 chr3A 92.793 111 7 1 4330 4440 583700411 583700520 5.410000e-35 159.0
18 TraesCS2A01G242700 chr3A 79.339 121 18 6 4569 4684 583703354 583703472 1.560000e-10 78.7
19 TraesCS2A01G242700 chr3D 91.163 2003 128 21 2272 4248 442392806 442394785 0.000000e+00 2673.0
20 TraesCS2A01G242700 chr3D 94.298 1210 54 6 1074 2272 442391551 442392756 0.000000e+00 1838.0
21 TraesCS2A01G242700 chr3D 91.535 697 32 5 386 1076 442390820 442391495 0.000000e+00 935.0
22 TraesCS2A01G242700 chr3D 87.149 249 7 5 2 249 442390594 442390818 5.180000e-65 259.0
23 TraesCS2A01G242700 chr3D 92.661 109 7 1 4330 4438 442394833 442394940 7.000000e-34 156.0
24 TraesCS2A01G242700 chr3D 81.667 120 16 5 4574 4688 442498852 442498970 1.550000e-15 95.3
25 TraesCS2A01G242700 chr3D 100.000 28 0 0 335 362 113802451 113802478 9.000000e-03 52.8
26 TraesCS2A01G242700 chr3D 100.000 28 0 0 335 362 496109052 496109025 9.000000e-03 52.8
27 TraesCS2A01G242700 chr2D 86.631 187 23 1 747 933 582694790 582694606 6.850000e-49 206.0
28 TraesCS2A01G242700 chr2D 97.059 34 0 1 335 367 531474598 531474565 7.300000e-04 56.5
29 TraesCS2A01G242700 chr2B 82.449 245 34 6 747 985 701751084 701750843 6.850000e-49 206.0
30 TraesCS2A01G242700 chr7D 95.192 104 2 2 236 337 609026656 609026758 1.500000e-35 161.0
31 TraesCS2A01G242700 chr7D 93.407 91 6 0 4775 4865 582461012 582460922 9.110000e-28 135.0
32 TraesCS2A01G242700 chr5D 97.849 93 2 0 245 337 508425830 508425922 1.500000e-35 161.0
33 TraesCS2A01G242700 chr5D 97.849 93 2 0 245 337 534192157 534192065 1.500000e-35 161.0
34 TraesCS2A01G242700 chr5D 92.708 96 5 2 4768 4863 113879304 113879397 2.530000e-28 137.0
35 TraesCS2A01G242700 chr5D 88.060 67 6 2 5056 5120 209319184 209319118 1.560000e-10 78.7
36 TraesCS2A01G242700 chr5D 100.000 28 0 0 335 362 264635042 264635015 9.000000e-03 52.8
37 TraesCS2A01G242700 chr4D 94.231 104 6 0 238 341 26898035 26897932 5.410000e-35 159.0
38 TraesCS2A01G242700 chr5B 92.708 96 6 1 4768 4863 689115708 689115802 2.530000e-28 137.0
39 TraesCS2A01G242700 chr5A 92.708 96 6 1 4766 4861 561124545 561124639 2.530000e-28 137.0
40 TraesCS2A01G242700 chr5A 100.000 28 0 0 335 362 450473654 450473627 9.000000e-03 52.8
41 TraesCS2A01G242700 chr6B 90.476 105 7 2 2 105 663532746 663532644 9.110000e-28 135.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G242700 chr2A 337858643 337863860 5217 False 9636.000000 9636 100.0000 1 5218 1 chr2A.!!$F2 5217
1 TraesCS2A01G242700 chr2A 337718851 337724054 5203 False 9367.000000 9367 99.1180 2 5218 1 chr2A.!!$F1 5216
2 TraesCS2A01G242700 chr2A 337854768 337856820 2052 True 3596.000000 3596 98.2960 2 2052 1 chr2A.!!$R2 2050
3 TraesCS2A01G242700 chr2A 337714988 337717035 2047 True 3552.000000 3552 97.9550 2 2052 1 chr2A.!!$R1 2050
4 TraesCS2A01G242700 chr7B 32019466 32024685 5219 True 9254.000000 9254 98.6780 2 5218 1 chr7B.!!$R1 5216
5 TraesCS2A01G242700 chr7B 32024969 32026024 1055 False 1838.000000 1838 98.1060 992 2046 1 chr7B.!!$F1 1054
6 TraesCS2A01G242700 chr3B 580029305 580033635 4330 False 3228.500000 6113 93.0835 2 4440 2 chr3B.!!$F2 4438
7 TraesCS2A01G242700 chr3A 583696163 583703472 7309 False 967.616667 2745 90.8430 2 4684 6 chr3A.!!$F1 4682
8 TraesCS2A01G242700 chr3D 442390594 442394940 4346 False 1172.200000 2673 91.3612 2 4438 5 chr3D.!!$F3 4436

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
693 743 3.768922 GCTGGAGAGCAGCGGTCT 61.769 66.667 9.46 9.46 45.46 3.85 F
2102 2225 5.250982 TCATTTGCTCTCACAGATGTCAAT 58.749 37.500 0.00 0.00 34.60 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2519 2700 9.841295 AGGAAATGTGACTTTTAACTTACACTA 57.159 29.63 0.00 0.0 0.00 2.74 R
4649 7595 2.107041 TAGCGTGGGGTGTCACTTGG 62.107 60.00 2.35 0.0 35.63 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
693 743 3.768922 GCTGGAGAGCAGCGGTCT 61.769 66.667 9.46 9.46 45.46 3.85
838 888 5.824904 AAGGCTGACTAACTTTGCATATG 57.175 39.130 0.00 0.00 0.00 1.78
2102 2225 5.250982 TCATTTGCTCTCACAGATGTCAAT 58.749 37.500 0.00 0.00 34.60 2.57
2519 2700 6.485648 GCACCAAAGTATCCGGAATATTAACT 59.514 38.462 9.01 2.59 0.00 2.24
3539 3755 7.068593 ACAATGAACCTTCACATTCTCTTTTCA 59.931 33.333 0.00 0.00 40.49 2.69
4649 7595 0.179094 TCTCGTCACCCACACAACAC 60.179 55.000 0.00 0.00 0.00 3.32
4929 7877 7.496591 CCAATCCACCGCTATAGTTAAGTTTTA 59.503 37.037 0.84 0.00 0.00 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
838 888 7.094205 ACAAAGTTGGTGGATCTTTGATCATAC 60.094 37.037 19.07 7.47 45.96 2.39
1090 1204 1.680735 TGTCCACTGCAAATGGTGAAC 59.319 47.619 14.73 7.91 38.47 3.18
1394 1509 7.617041 AAGTGGATTGTTCTACTAGCAATTC 57.383 36.000 0.00 0.00 42.30 2.17
2519 2700 9.841295 AGGAAATGTGACTTTTAACTTACACTA 57.159 29.630 0.00 0.00 0.00 2.74
4649 7595 2.107041 TAGCGTGGGGTGTCACTTGG 62.107 60.000 2.35 0.00 35.63 3.61
4780 7728 0.462047 GTTCGAATCCTGCCGACCAT 60.462 55.000 0.00 0.00 34.26 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.