Multiple sequence alignment - TraesCS2A01G241800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G241800 chr2A 100.000 2216 0 0 1 2216 335838457 335836242 0 4093
1 TraesCS2A01G241800 chr3D 97.763 2235 30 4 1 2216 589279713 589281946 0 3832
2 TraesCS2A01G241800 chr1D 97.452 2237 36 4 1 2216 254398280 254400516 0 3795
3 TraesCS2A01G241800 chr5D 97.407 2237 36 5 1 2216 6188769 6186534 0 3790
4 TraesCS2A01G241800 chr5D 97.361 2236 38 4 1 2216 503278397 503280631 0 3783
5 TraesCS2A01G241800 chr5D 96.609 2212 49 9 1 2190 432403668 432405875 0 3646
6 TraesCS2A01G241800 chr5D 97.653 1278 17 1 1 1265 503218047 503216770 0 2182
7 TraesCS2A01G241800 chr1A 97.255 2186 31 4 1 2165 554512077 554509900 0 3677
8 TraesCS2A01G241800 chr5A 95.979 2238 66 7 1 2216 607274229 607271994 0 3613
9 TraesCS2A01G241800 chr4A 95.457 2245 72 8 1 2216 309514960 309512717 0 3554
10 TraesCS2A01G241800 chr4A 94.735 2260 69 18 1 2216 310738426 310736173 0 3469
11 TraesCS2A01G241800 chr4B 95.355 2239 66 10 1 2216 308696299 308694076 0 3524
12 TraesCS2A01G241800 chr6D 96.693 1875 35 8 367 2216 45519037 45517165 0 3094
13 TraesCS2A01G241800 chr6D 97.498 1279 18 2 1 1265 168251935 168253213 0 2172
14 TraesCS2A01G241800 chr6D 97.498 1279 18 2 1 1265 168254755 168253477 0 2172
15 TraesCS2A01G241800 chrUn 97.811 1279 13 3 1 1265 93409802 93411079 0 2193
16 TraesCS2A01G241800 chrUn 97.576 1279 17 2 1 1265 216518773 216520051 0 2178
17 TraesCS2A01G241800 chrUn 97.498 1279 18 2 1 1265 216521593 216520315 0 2172
18 TraesCS2A01G241800 chr3B 97.498 1279 17 3 1 1265 201526853 201525576 0 2170
19 TraesCS2A01G241800 chr2B 96.772 1301 25 4 1 1288 474908282 474906986 0 2154


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G241800 chr2A 335836242 335838457 2215 True 4093 4093 100.000 1 2216 1 chr2A.!!$R1 2215
1 TraesCS2A01G241800 chr3D 589279713 589281946 2233 False 3832 3832 97.763 1 2216 1 chr3D.!!$F1 2215
2 TraesCS2A01G241800 chr1D 254398280 254400516 2236 False 3795 3795 97.452 1 2216 1 chr1D.!!$F1 2215
3 TraesCS2A01G241800 chr5D 6186534 6188769 2235 True 3790 3790 97.407 1 2216 1 chr5D.!!$R1 2215
4 TraesCS2A01G241800 chr5D 503278397 503280631 2234 False 3783 3783 97.361 1 2216 1 chr5D.!!$F2 2215
5 TraesCS2A01G241800 chr5D 432403668 432405875 2207 False 3646 3646 96.609 1 2190 1 chr5D.!!$F1 2189
6 TraesCS2A01G241800 chr5D 503216770 503218047 1277 True 2182 2182 97.653 1 1265 1 chr5D.!!$R2 1264
7 TraesCS2A01G241800 chr1A 554509900 554512077 2177 True 3677 3677 97.255 1 2165 1 chr1A.!!$R1 2164
8 TraesCS2A01G241800 chr5A 607271994 607274229 2235 True 3613 3613 95.979 1 2216 1 chr5A.!!$R1 2215
9 TraesCS2A01G241800 chr4A 309512717 309514960 2243 True 3554 3554 95.457 1 2216 1 chr4A.!!$R1 2215
10 TraesCS2A01G241800 chr4A 310736173 310738426 2253 True 3469 3469 94.735 1 2216 1 chr4A.!!$R2 2215
11 TraesCS2A01G241800 chr4B 308694076 308696299 2223 True 3524 3524 95.355 1 2216 1 chr4B.!!$R1 2215
12 TraesCS2A01G241800 chr6D 45517165 45519037 1872 True 3094 3094 96.693 367 2216 1 chr6D.!!$R1 1849
13 TraesCS2A01G241800 chr6D 168251935 168253213 1278 False 2172 2172 97.498 1 1265 1 chr6D.!!$F1 1264
14 TraesCS2A01G241800 chr6D 168253477 168254755 1278 True 2172 2172 97.498 1 1265 1 chr6D.!!$R2 1264
15 TraesCS2A01G241800 chrUn 93409802 93411079 1277 False 2193 2193 97.811 1 1265 1 chrUn.!!$F1 1264
16 TraesCS2A01G241800 chrUn 216518773 216520051 1278 False 2178 2178 97.576 1 1265 1 chrUn.!!$F2 1264
17 TraesCS2A01G241800 chrUn 216520315 216521593 1278 True 2172 2172 97.498 1 1265 1 chrUn.!!$R1 1264
18 TraesCS2A01G241800 chr3B 201525576 201526853 1277 True 2170 2170 97.498 1 1265 1 chr3B.!!$R1 1264
19 TraesCS2A01G241800 chr2B 474906986 474908282 1296 True 2154 2154 96.772 1 1288 1 chr2B.!!$R1 1287

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
761 789 0.725117 GCGAACGACGGGAATTGAAT 59.275 50.0 0.0 0.0 42.83 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1594 1660 7.280205 AGTTTCAACAACTCTCGTTCTTTACAT 59.72 33.333 0.0 0.0 0.0 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 94 8.489676 AGGATGTAGAAGATCATAACATGAGT 57.510 34.615 0.00 0.00 43.53 3.41
166 185 5.720371 AGATCCATTTGTCTAGAGATCGG 57.280 43.478 10.21 3.55 36.19 4.18
761 789 0.725117 GCGAACGACGGGAATTGAAT 59.275 50.000 0.00 0.00 42.83 2.57
1162 1211 0.255033 GGGGGAATTCGTGCCTACTT 59.745 55.000 0.00 0.00 37.99 2.24
1307 1366 6.918892 TGTTGATATTGGGTATTTCTGTCG 57.081 37.500 0.00 0.00 0.00 4.35
1594 1660 0.675633 GCCAAGCAGCCAAGAAGAAA 59.324 50.000 0.00 0.00 0.00 2.52
1847 1913 4.486125 TGCATAAGGATGTTGTGCTCTA 57.514 40.909 7.79 0.00 37.42 2.43
2089 2156 6.763715 ATTAGCTCATAAGGACCACCATTA 57.236 37.500 0.00 0.00 38.94 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 6.916909 TGATCTTCTACATCCTAGGTCTCTT 58.083 40.000 9.08 0.00 0.00 2.85
75 94 2.951642 GGAATCCAAATCTGCCGAATCA 59.048 45.455 0.00 0.00 0.00 2.57
152 171 6.887002 AGATGTATATGCCGATCTCTAGACAA 59.113 38.462 0.00 0.00 0.00 3.18
166 185 7.971168 AGCATACGACTTTCTAGATGTATATGC 59.029 37.037 25.18 25.18 38.81 3.14
475 495 2.544685 CAACACTTAGATCCGGCTCTG 58.455 52.381 18.06 4.62 0.00 3.35
603 627 0.258774 AAGCGCAGGATAACCCCAAT 59.741 50.000 11.47 0.00 36.73 3.16
761 789 2.513666 GAATCCACCATGCGCGGA 60.514 61.111 8.83 5.00 0.00 5.54
867 912 5.048921 TGTCCAATATCTCGATCGAAGTACC 60.049 44.000 19.92 2.08 0.00 3.34
1162 1211 5.697473 TTTTCATAACTCGTGAAATGCCA 57.303 34.783 2.57 0.00 43.00 4.92
1524 1589 9.408069 CTTTAGGTATTAGTACTATGGCTTTCG 57.592 37.037 2.79 0.00 0.00 3.46
1594 1660 7.280205 AGTTTCAACAACTCTCGTTCTTTACAT 59.720 33.333 0.00 0.00 0.00 2.29
1847 1913 8.877864 TTCAACTTTATGATTGTATTCCAGGT 57.122 30.769 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.