Multiple sequence alignment - TraesCS2A01G241700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G241700 chr2A 100.000 3052 0 0 1 3052 335830613 335833664 0 5637
1 TraesCS2A01G241700 chr5D 97.414 3055 53 17 1 3052 503287314 503284283 0 5180
2 TraesCS2A01G241700 chr5D 97.054 3055 60 17 1 3052 6180931 6183958 0 5116
3 TraesCS2A01G241700 chr5D 95.617 3057 99 14 1 3052 167071949 167068923 0 4870
4 TraesCS2A01G241700 chr5D 96.692 2781 67 14 1 2777 120799885 120797126 0 4602
5 TraesCS2A01G241700 chr3B 97.284 3056 57 13 1 3052 101919030 101922063 0 5160
6 TraesCS2A01G241700 chr6D 97.090 3058 56 15 1 3052 45511556 45514586 0 5123
7 TraesCS2A01G241700 chr1D 96.727 3055 71 16 1 3052 51878058 51881086 0 5060
8 TraesCS2A01G241700 chr4A 95.582 3056 99 21 1 3052 310730586 310733609 0 4863
9 TraesCS2A01G241700 chr4B 95.041 3065 119 21 1 3052 308688468 308691512 0 4787
10 TraesCS2A01G241700 chr7B 95.663 2398 95 6 1 2395 105256580 105258971 0 3843
11 TraesCS2A01G241700 chrUn 95.708 1095 25 8 1948 3041 442413364 442414437 0 1742


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G241700 chr2A 335830613 335833664 3051 False 5637 5637 100.000 1 3052 1 chr2A.!!$F1 3051
1 TraesCS2A01G241700 chr5D 503284283 503287314 3031 True 5180 5180 97.414 1 3052 1 chr5D.!!$R3 3051
2 TraesCS2A01G241700 chr5D 6180931 6183958 3027 False 5116 5116 97.054 1 3052 1 chr5D.!!$F1 3051
3 TraesCS2A01G241700 chr5D 167068923 167071949 3026 True 4870 4870 95.617 1 3052 1 chr5D.!!$R2 3051
4 TraesCS2A01G241700 chr5D 120797126 120799885 2759 True 4602 4602 96.692 1 2777 1 chr5D.!!$R1 2776
5 TraesCS2A01G241700 chr3B 101919030 101922063 3033 False 5160 5160 97.284 1 3052 1 chr3B.!!$F1 3051
6 TraesCS2A01G241700 chr6D 45511556 45514586 3030 False 5123 5123 97.090 1 3052 1 chr6D.!!$F1 3051
7 TraesCS2A01G241700 chr1D 51878058 51881086 3028 False 5060 5060 96.727 1 3052 1 chr1D.!!$F1 3051
8 TraesCS2A01G241700 chr4A 310730586 310733609 3023 False 4863 4863 95.582 1 3052 1 chr4A.!!$F1 3051
9 TraesCS2A01G241700 chr4B 308688468 308691512 3044 False 4787 4787 95.041 1 3052 1 chr4B.!!$F1 3051
10 TraesCS2A01G241700 chr7B 105256580 105258971 2391 False 3843 3843 95.663 1 2395 1 chr7B.!!$F1 2394
11 TraesCS2A01G241700 chrUn 442413364 442414437 1073 False 1742 1742 95.708 1948 3041 1 chrUn.!!$F1 1093

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
459 470 3.137913 AGCACATTCAGGATATGCCTCTT 59.862 43.478 0.0 0.0 46.97 2.85 F
1161 1176 5.339008 ACATAGCCTGTTCTATTCGTTCA 57.661 39.130 0.0 0.0 32.90 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1266 1283 4.327680 AGACTGACAAAGTTGGCCTATTC 58.672 43.478 3.32 0.0 40.07 1.75 R
2507 2541 1.268335 CCAAAACGAACAAGTCCGGTG 60.268 52.381 0.00 0.0 0.00 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 132 8.285163 AGCAAGAGAATATCCCTCCTTTTTATT 58.715 33.333 0.00 0.0 0.00 1.40
315 326 9.051679 CAAACGGTGAAATCATATAGTATTCCA 57.948 33.333 0.00 0.0 0.00 3.53
459 470 3.137913 AGCACATTCAGGATATGCCTCTT 59.862 43.478 0.00 0.0 46.97 2.85
1161 1176 5.339008 ACATAGCCTGTTCTATTCGTTCA 57.661 39.130 0.00 0.0 32.90 3.18
1528 1548 7.839680 AAAGGATTCCAGAACAAGTAAACAT 57.160 32.000 5.29 0.0 0.00 2.71
1530 1550 8.567285 AAGGATTCCAGAACAAGTAAACATAG 57.433 34.615 5.29 0.0 0.00 2.23
1624 1644 8.727910 ACAAAGAAAAGAGTTTAAAGACGACTT 58.272 29.630 0.00 0.0 38.05 3.01
1625 1645 9.000018 CAAAGAAAAGAGTTTAAAGACGACTTG 58.000 33.333 0.00 0.0 36.39 3.16
1664 1684 1.134220 TGCCTTCGAAGTTTGTCAGGT 60.134 47.619 23.03 0.0 0.00 4.00
2030 2057 9.474313 ACTGTTTATGATATTTTAAGGAAGGCA 57.526 29.630 0.00 0.0 0.00 4.75
2556 2591 7.265647 TGAGTGTTTTTCATGGTCGATAAAA 57.734 32.000 0.00 0.0 0.00 1.52
2700 2737 5.105997 GGTAGAGTACTCGGCTTTTAAGTGA 60.106 44.000 17.07 0.0 34.09 3.41
2771 2809 6.080969 TCTTGGTAGAGTCTAGAAGACCAT 57.919 41.667 11.65 0.0 46.18 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
427 438 5.619132 TCCTGAATGTGCTTGATAGATCA 57.381 39.130 0.00 0.00 34.44 2.92
775 789 9.465985 TTTGAAAAAGACGACTAAACAAGTTTT 57.534 25.926 3.25 0.00 39.07 2.43
1161 1176 0.318120 CCCAGCGCAAATTTGGTTCT 59.682 50.000 19.47 1.66 0.00 3.01
1266 1283 4.327680 AGACTGACAAAGTTGGCCTATTC 58.672 43.478 3.32 0.00 40.07 1.75
1268 1285 5.396884 GGATAGACTGACAAAGTTGGCCTAT 60.397 44.000 3.32 0.00 40.07 2.57
1452 1472 6.749036 AGACATTACTTCGGGAATTCCTAT 57.251 37.500 23.63 7.88 35.95 2.57
1528 1548 8.275015 TCTGTTGTTGAGACAATTGAAAACTA 57.725 30.769 13.59 5.16 46.63 2.24
1530 1550 7.029563 ACTCTGTTGTTGAGACAATTGAAAAC 58.970 34.615 13.59 10.63 46.63 2.43
1624 1644 6.363882 AGGCAAAATCCTTCCAAAATTTTCA 58.636 32.000 0.00 0.00 31.91 2.69
1625 1645 6.882610 AGGCAAAATCCTTCCAAAATTTTC 57.117 33.333 0.00 0.00 31.91 2.29
1664 1684 6.480763 TCATGACTCAAGTGGGCTAATTTTA 58.519 36.000 0.00 0.00 0.00 1.52
1759 1779 7.201732 GGCTCGAGAAAATGATTGGAATTTCTA 60.202 37.037 18.75 0.00 41.00 2.10
1768 1788 4.507756 TCATACGGCTCGAGAAAATGATTG 59.492 41.667 18.75 2.85 0.00 2.67
2247 2275 6.824305 AGACCTTTGTCAATGGAAATACAG 57.176 37.500 21.20 0.00 44.33 2.74
2432 2466 7.168135 GCCAAATTCTCCTTATTTTTAGCGATG 59.832 37.037 0.00 0.00 0.00 3.84
2501 2535 2.946990 ACGAACAAGTCCGGTGAAAATT 59.053 40.909 0.00 0.00 0.00 1.82
2503 2537 2.027003 ACGAACAAGTCCGGTGAAAA 57.973 45.000 0.00 0.00 0.00 2.29
2507 2541 1.268335 CCAAAACGAACAAGTCCGGTG 60.268 52.381 0.00 0.00 0.00 4.94
2515 2549 3.862267 CACTCAAATGCCAAAACGAACAA 59.138 39.130 0.00 0.00 0.00 2.83
2556 2591 9.468532 GAACTAGCAAGACATCAAAAGATTTTT 57.531 29.630 0.00 0.00 0.00 1.94
2700 2737 9.911788 ATCCAAATGTGTAAAAGATCATAGTCT 57.088 29.630 0.00 0.00 0.00 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.