Multiple sequence alignment - TraesCS2A01G241600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G241600 chr2A 100.000 2194 0 0 1 2194 335831468 335829275 0 4052
1 TraesCS2A01G241600 chr5D 97.677 1636 28 8 1 1628 503286460 503288093 0 2802
2 TraesCS2A01G241600 chr5D 97.674 1634 28 9 1 1628 6181784 6180155 0 2798
3 TraesCS2A01G241600 chr5D 97.548 1631 36 4 1 1628 120799030 120800659 0 2787
4 TraesCS2A01G241600 chr5D 96.328 1634 54 5 1 1628 167071093 167072726 0 2680
5 TraesCS2A01G241600 chr5D 98.594 569 6 2 1628 2194 503217165 503216597 0 1005
6 TraesCS2A01G241600 chr6D 97.492 1635 25 10 1 1628 45512404 45510779 0 2778
7 TraesCS2A01G241600 chr6D 98.243 569 8 2 1628 2194 168250487 168249919 0 994
8 TraesCS2A01G241600 chr6D 98.246 570 7 2 1628 2194 168253873 168253304 0 994
9 TraesCS2A01G241600 chr1D 97.428 1633 34 6 1 1628 51878912 51877283 0 2776
10 TraesCS2A01G241600 chr1D 97.181 1632 32 5 1 1628 254416224 254417845 0 2747
11 TraesCS2A01G241600 chr1D 95.463 1631 70 4 1 1628 260891267 260892896 0 2599
12 TraesCS2A01G241600 chr4A 95.775 1633 55 11 1 1628 310731434 310729811 0 2621
13 TraesCS2A01G241600 chr4A 95.527 1632 52 10 1 1628 309507974 309506360 0 2590
14 TraesCS2A01G241600 chrUn 98.594 569 6 2 1628 2194 396206413 396206981 0 1005
15 TraesCS2A01G241600 chrUn 98.421 570 6 2 1628 2194 93410683 93411252 0 1000
16 TraesCS2A01G241600 chrUn 98.070 570 8 2 1628 2194 216519655 216520224 0 989
17 TraesCS2A01G241600 chr7D 98.421 570 6 2 1628 2194 231547540 231546971 0 1000
18 TraesCS2A01G241600 chr2D 98.070 570 8 2 1628 2194 272794946 272795515 0 989
19 TraesCS2A01G241600 chr6A 97.887 568 11 1 1628 2194 260117334 260117901 0 981


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G241600 chr2A 335829275 335831468 2193 True 4052 4052 100.0000 1 2194 1 chr2A.!!$R1 2193
1 TraesCS2A01G241600 chr5D 503286460 503288093 1633 False 2802 2802 97.6770 1 1628 1 chr5D.!!$F3 1627
2 TraesCS2A01G241600 chr5D 6180155 6181784 1629 True 2798 2798 97.6740 1 1628 1 chr5D.!!$R1 1627
3 TraesCS2A01G241600 chr5D 120799030 120800659 1629 False 2787 2787 97.5480 1 1628 1 chr5D.!!$F1 1627
4 TraesCS2A01G241600 chr5D 167071093 167072726 1633 False 2680 2680 96.3280 1 1628 1 chr5D.!!$F2 1627
5 TraesCS2A01G241600 chr5D 503216597 503217165 568 True 1005 1005 98.5940 1628 2194 1 chr5D.!!$R2 566
6 TraesCS2A01G241600 chr6D 45510779 45512404 1625 True 2778 2778 97.4920 1 1628 1 chr6D.!!$R1 1627
7 TraesCS2A01G241600 chr6D 168249919 168253873 3954 True 994 994 98.2445 1628 2194 2 chr6D.!!$R2 566
8 TraesCS2A01G241600 chr1D 51877283 51878912 1629 True 2776 2776 97.4280 1 1628 1 chr1D.!!$R1 1627
9 TraesCS2A01G241600 chr1D 254416224 254417845 1621 False 2747 2747 97.1810 1 1628 1 chr1D.!!$F1 1627
10 TraesCS2A01G241600 chr1D 260891267 260892896 1629 False 2599 2599 95.4630 1 1628 1 chr1D.!!$F2 1627
11 TraesCS2A01G241600 chr4A 310729811 310731434 1623 True 2621 2621 95.7750 1 1628 1 chr4A.!!$R2 1627
12 TraesCS2A01G241600 chr4A 309506360 309507974 1614 True 2590 2590 95.5270 1 1628 1 chr4A.!!$R1 1627
13 TraesCS2A01G241600 chrUn 396206413 396206981 568 False 1005 1005 98.5940 1628 2194 1 chrUn.!!$F3 566
14 TraesCS2A01G241600 chrUn 93410683 93411252 569 False 1000 1000 98.4210 1628 2194 1 chrUn.!!$F1 566
15 TraesCS2A01G241600 chrUn 216519655 216520224 569 False 989 989 98.0700 1628 2194 1 chrUn.!!$F2 566
16 TraesCS2A01G241600 chr7D 231546971 231547540 569 True 1000 1000 98.4210 1628 2194 1 chr7D.!!$R1 566
17 TraesCS2A01G241600 chr2D 272794946 272795515 569 False 989 989 98.0700 1628 2194 1 chr2D.!!$F1 566
18 TraesCS2A01G241600 chr6A 260117334 260117901 567 False 981 981 97.8870 1628 2194 1 chr6A.!!$F1 566

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
428 434 5.619132 TCCTGAATGTGCTTGATAGATCA 57.381 39.13 0.0 0.0 34.44 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1680 1701 4.776795 TTCGTGTCACAGCTGATTACTA 57.223 40.909 23.35 3.2 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 81 9.465985 TTTGAAAAAGACGACTAAACAAGTTTT 57.534 25.926 3.25 0.00 39.07 2.43
428 434 5.619132 TCCTGAATGTGCTTGATAGATCA 57.381 39.130 0.00 0.00 34.44 2.92
900 907 5.897250 AGGTATTTTGTGTTTGGGAAAGTCT 59.103 36.000 0.00 0.00 0.00 3.24
1180 1190 3.445450 TGGCAAGTTGCTGTAAGTTTTCA 59.555 39.130 26.16 9.59 44.28 2.69
1182 1192 4.867608 GGCAAGTTGCTGTAAGTTTTCAAA 59.132 37.500 26.16 0.00 44.28 2.69
1332 1346 6.553953 TCTACATTGAATGGGTAGCTACAA 57.446 37.500 24.75 13.05 35.58 2.41
1639 1660 9.661187 GTAGTGATATTCTTTACTTCGATCGAA 57.339 33.333 27.54 27.54 0.00 3.71
1673 1694 7.451566 ACATAGAATGCCACTCTTTAAAAAGGT 59.548 33.333 2.77 0.00 36.67 3.50
1680 1701 7.842982 TGCCACTCTTTAAAAAGGTAAAAAGT 58.157 30.769 2.77 0.00 36.67 2.66
2048 5458 3.503800 AGGCGGGGAATAACCTTATTC 57.496 47.619 8.68 8.68 45.16 1.75
2153 5563 5.047802 TCCAACCGATCGTCTACTTAAGTTT 60.048 40.000 14.49 0.00 0.00 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
396 402 3.137913 AGCACATTCAGGATATGCCTCTT 59.862 43.478 0.00 0.0 46.97 2.85
725 731 8.285163 AGCAAGAGAATATCCCTCCTTTTTATT 58.715 33.333 0.00 0.0 0.00 1.40
1165 1175 9.651913 AAAGATTTCTTTGAAAACTTACAGCAA 57.348 25.926 13.25 0.0 43.87 3.91
1332 1346 7.486407 AGAAAGGCTGATCCAAATTTATTGT 57.514 32.000 0.00 0.0 37.29 2.71
1639 1660 6.845908 AGAGTGGCATTCTATGTCCAATATT 58.154 36.000 11.16 0.0 37.89 1.28
1673 1694 7.115805 CGTGTCACAGCTGATTACTACTTTTTA 59.884 37.037 23.35 0.0 0.00 1.52
1680 1701 4.776795 TTCGTGTCACAGCTGATTACTA 57.223 40.909 23.35 3.2 0.00 1.82
1835 1857 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.00 0.0 0.00 3.73
2153 5563 5.895636 TTTGTGCTTTGAAAACTCTCTCA 57.104 34.783 0.00 0.0 0.00 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.