Multiple sequence alignment - TraesCS2A01G241500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G241500 chr2A 100.000 2216 0 0 1 2216 335830711 335828496 0.000000e+00 4093
1 TraesCS2A01G241500 chr2A 95.960 99 4 0 871 969 588452191 588452093 6.330000e-36 161
2 TraesCS2A01G241500 chrUn 98.298 1351 18 4 871 2216 93410683 93412033 0.000000e+00 2362
3 TraesCS2A01G241500 chr5D 98.147 1349 22 3 871 2216 503217165 503215817 0.000000e+00 2350
4 TraesCS2A01G241500 chr5D 96.972 1354 34 5 867 2216 329121155 329122505 0.000000e+00 2266
5 TraesCS2A01G241500 chr5D 97.714 875 16 3 1 871 6181029 6180155 0.000000e+00 1502
6 TraesCS2A01G241500 chr5D 97.153 878 17 6 1 871 503287217 503288093 0.000000e+00 1476
7 TraesCS2A01G241500 chr5D 97.022 873 23 3 1 871 120799788 120800659 0.000000e+00 1465
8 TraesCS2A01G241500 chr5D 96.233 876 28 4 1 871 167071851 167072726 0.000000e+00 1430
9 TraesCS2A01G241500 chr6D 97.852 1350 25 4 871 2216 168250487 168249138 0.000000e+00 2329
10 TraesCS2A01G241500 chr6D 97.948 877 11 5 1 871 45511654 45510779 0.000000e+00 1513
11 TraesCS2A01G241500 chr2D 97.853 1351 23 5 871 2216 272794946 272796295 0.000000e+00 2329
12 TraesCS2A01G241500 chr2D 97.025 874 12 5 1 871 9785061 9785923 0.000000e+00 1458
13 TraesCS2A01G241500 chr3A 97.039 1351 33 7 871 2216 672911061 672912409 0.000000e+00 2266
14 TraesCS2A01G241500 chr6A 96.600 1353 37 6 871 2216 260117334 260118684 0.000000e+00 2235
15 TraesCS2A01G241500 chr7A 94.510 1348 65 7 871 2216 352182865 352184205 0.000000e+00 2071
16 TraesCS2A01G241500 chr1D 96.239 1223 38 7 995 2216 397109208 397110423 0.000000e+00 1997
17 TraesCS2A01G241500 chr1D 97.714 875 15 4 1 871 51878156 51877283 0.000000e+00 1500
18 TraesCS2A01G241500 chr1D 95.189 873 40 2 1 871 260892024 260892896 0.000000e+00 1378
19 TraesCS2A01G241500 chr4A 95.767 874 33 4 1 871 310730683 310729811 0.000000e+00 1406


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G241500 chr2A 335828496 335830711 2215 True 4093 4093 100.000 1 2216 1 chr2A.!!$R1 2215
1 TraesCS2A01G241500 chrUn 93410683 93412033 1350 False 2362 2362 98.298 871 2216 1 chrUn.!!$F1 1345
2 TraesCS2A01G241500 chr5D 503215817 503217165 1348 True 2350 2350 98.147 871 2216 1 chr5D.!!$R2 1345
3 TraesCS2A01G241500 chr5D 329121155 329122505 1350 False 2266 2266 96.972 867 2216 1 chr5D.!!$F3 1349
4 TraesCS2A01G241500 chr5D 6180155 6181029 874 True 1502 1502 97.714 1 871 1 chr5D.!!$R1 870
5 TraesCS2A01G241500 chr5D 503287217 503288093 876 False 1476 1476 97.153 1 871 1 chr5D.!!$F4 870
6 TraesCS2A01G241500 chr5D 120799788 120800659 871 False 1465 1465 97.022 1 871 1 chr5D.!!$F1 870
7 TraesCS2A01G241500 chr5D 167071851 167072726 875 False 1430 1430 96.233 1 871 1 chr5D.!!$F2 870
8 TraesCS2A01G241500 chr6D 168249138 168250487 1349 True 2329 2329 97.852 871 2216 1 chr6D.!!$R2 1345
9 TraesCS2A01G241500 chr6D 45510779 45511654 875 True 1513 1513 97.948 1 871 1 chr6D.!!$R1 870
10 TraesCS2A01G241500 chr2D 272794946 272796295 1349 False 2329 2329 97.853 871 2216 1 chr2D.!!$F2 1345
11 TraesCS2A01G241500 chr2D 9785061 9785923 862 False 1458 1458 97.025 1 871 1 chr2D.!!$F1 870
12 TraesCS2A01G241500 chr3A 672911061 672912409 1348 False 2266 2266 97.039 871 2216 1 chr3A.!!$F1 1345
13 TraesCS2A01G241500 chr6A 260117334 260118684 1350 False 2235 2235 96.600 871 2216 1 chr6A.!!$F1 1345
14 TraesCS2A01G241500 chr7A 352182865 352184205 1340 False 2071 2071 94.510 871 2216 1 chr7A.!!$F1 1345
15 TraesCS2A01G241500 chr1D 397109208 397110423 1215 False 1997 1997 96.239 995 2216 1 chr1D.!!$F2 1221
16 TraesCS2A01G241500 chr1D 51877283 51878156 873 True 1500 1500 97.714 1 871 1 chr1D.!!$R1 870
17 TraesCS2A01G241500 chr1D 260892024 260892896 872 False 1378 1378 95.189 1 871 1 chr1D.!!$F1 870
18 TraesCS2A01G241500 chr4A 310729811 310730683 872 True 1406 1406 95.767 1 871 1 chr4A.!!$R1 870

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
423 428 3.44545 TGGCAAGTTGCTGTAAGTTTTCA 59.555 39.13 26.16 9.59 44.28 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1543 1566 1.476488 GTGGCTGCCGAATAAACCAAT 59.524 47.619 14.98 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
143 144 5.897250 AGGTATTTTGTGTTTGGGAAAGTCT 59.103 36.000 0.00 0.00 0.00 3.24
423 428 3.445450 TGGCAAGTTGCTGTAAGTTTTCA 59.555 39.130 26.16 9.59 44.28 2.69
425 430 4.867608 GGCAAGTTGCTGTAAGTTTTCAAA 59.132 37.500 26.16 0.00 44.28 2.69
575 582 6.553953 TCTACATTGAATGGGTAGCTACAA 57.446 37.500 24.75 13.05 35.58 2.41
882 896 9.661187 GTAGTGATATTCTTTACTTCGATCGAA 57.339 33.333 27.54 27.54 0.00 3.71
916 930 7.451566 ACATAGAATGCCACTCTTTAAAAAGGT 59.548 33.333 2.77 0.00 36.67 3.50
923 939 7.842982 TGCCACTCTTTAAAAAGGTAAAAAGT 58.157 30.769 2.77 0.00 36.67 2.66
1291 1314 3.503800 AGGCGGGGAATAACCTTATTC 57.496 47.619 8.68 8.68 45.16 1.75
1396 1419 5.047802 TCCAACCGATCGTCTACTTAAGTTT 60.048 40.000 14.49 0.00 0.00 2.66
1543 1566 6.826668 TCGAGCATCTTATCCCATCTTAAAA 58.173 36.000 0.00 0.00 0.00 1.52
1562 1585 1.846007 ATTGGTTTATTCGGCAGCCA 58.154 45.000 13.30 0.00 0.00 4.75
1663 1690 2.086054 AGAAATTCAGACGCGAGCTT 57.914 45.000 15.93 0.00 0.00 3.74
1672 1699 2.430921 CGCGAGCTTGAGGACGTT 60.431 61.111 4.70 0.00 0.00 3.99
1777 1810 9.681062 ATCTAAGATTTCGATTCCCAGTAAAAA 57.319 29.630 0.00 0.00 0.00 1.94
1907 1942 7.792364 TTCTGAAGGTCTACAGGAAGATAAA 57.208 36.000 0.00 0.00 35.20 1.40
1982 2017 9.046296 GGCTCGAATAGAAAAATAGAATCAGAA 57.954 33.333 0.00 0.00 0.00 3.02
2052 2087 7.359262 TCAAGTTCCGAAGTAATTACACATG 57.641 36.000 17.65 8.87 0.00 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
575 582 7.486407 AGAAAGGCTGATCCAAATTTATTGT 57.514 32.000 0.00 0.0 37.29 2.71
882 896 6.845908 AGAGTGGCATTCTATGTCCAATATT 58.154 36.000 11.16 0.0 37.89 1.28
916 930 7.115805 CGTGTCACAGCTGATTACTACTTTTTA 59.884 37.037 23.35 0.0 0.00 1.52
923 939 4.776795 TTCGTGTCACAGCTGATTACTA 57.223 40.909 23.35 3.2 0.00 1.82
1078 1095 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.00 0.0 0.00 3.73
1396 1419 5.895636 TTTGTGCTTTGAAAACTCTCTCA 57.104 34.783 0.00 0.0 0.00 3.27
1543 1566 1.476488 GTGGCTGCCGAATAAACCAAT 59.524 47.619 14.98 0.0 0.00 3.16
1562 1585 9.646522 AAAATCCCTATAATGAGTAGCATTTGT 57.353 29.630 0.00 0.0 44.68 2.83
1663 1690 2.222885 TGGGGAAACAACGTCCTCA 58.777 52.632 0.00 0.0 43.67 3.86
1982 2017 9.661563 TTATGTGTAATTACTTCGGAACTTGAT 57.338 29.630 16.33 0.0 0.00 2.57
2052 2087 9.422196 CGTATCGATTTCTTTTTGGATTTCTAC 57.578 33.333 1.71 0.0 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.