Multiple sequence alignment - TraesCS2A01G241300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2A01G241300 chr2A 100.000 2477 0 0 1 2477 335829914 335827438 0.000000e+00 4575
1 TraesCS2A01G241300 chr2A 98.713 544 6 1 1835 2378 588084429 588083887 0.000000e+00 965
2 TraesCS2A01G241300 chr2A 95.960 99 4 0 74 172 588452191 588452093 7.090000e-36 161
3 TraesCS2A01G241300 chrUn 98.131 1766 28 4 74 1834 93410683 93412448 0.000000e+00 3073
4 TraesCS2A01G241300 chrUn 96.520 661 5 2 1835 2477 317471369 317472029 0.000000e+00 1077
5 TraesCS2A01G241300 chr5D 97.963 1767 32 4 74 1837 503217165 503215400 0.000000e+00 3061
6 TraesCS2A01G241300 chr5D 96.900 1774 47 6 70 1838 329121155 329122925 0.000000e+00 2964
7 TraesCS2A01G241300 chr5D 96.520 661 5 2 1835 2477 554198632 554197972 0.000000e+00 1077
8 TraesCS2A01G241300 chr5D 96.520 661 3 3 1835 2477 554199185 554199843 0.000000e+00 1075
9 TraesCS2A01G241300 chr5D 96.218 661 7 2 1835 2477 6206006 6206666 0.000000e+00 1066
10 TraesCS2A01G241300 chr5D 98.667 75 0 1 1 74 6180229 6180155 5.560000e-27 132
11 TraesCS2A01G241300 chr5D 98.649 74 1 0 1 74 167072653 167072726 5.560000e-27 132
12 TraesCS2A01G241300 chr5D 98.667 75 0 1 1 74 512408831 512408757 5.560000e-27 132
13 TraesCS2A01G241300 chr6D 97.851 1768 34 4 74 1837 168250487 168248720 0.000000e+00 3051
14 TraesCS2A01G241300 chr6D 96.974 661 2 7 1835 2477 431404724 431404064 0.000000e+00 1094
15 TraesCS2A01G241300 chr6D 96.672 661 4 2 1835 2477 431401843 431401183 0.000000e+00 1083
16 TraesCS2A01G241300 chr6D 96.520 661 5 2 1835 2477 431402396 431403056 0.000000e+00 1077
17 TraesCS2A01G241300 chr6D 98.667 75 0 1 1 74 45510853 45510779 5.560000e-27 132
18 TraesCS2A01G241300 chr2D 97.905 1766 31 5 74 1834 272794946 272796710 0.000000e+00 3051
19 TraesCS2A01G241300 chr3A 97.112 1766 44 7 74 1834 672911061 672912824 0.000000e+00 2972
20 TraesCS2A01G241300 chr6A 96.719 1768 47 8 74 1834 260117334 260119097 0.000000e+00 2933
21 TraesCS2A01G241300 chr6A 100.000 74 0 0 1 74 53818671 53818598 1.190000e-28 137
22 TraesCS2A01G241300 chr7A 94.274 1764 90 9 74 1834 352182865 352184620 0.000000e+00 2687
23 TraesCS2A01G241300 chr1D 95.790 1639 60 8 198 1834 397109208 397110839 0.000000e+00 2636
24 TraesCS2A01G241300 chr1D 96.672 661 4 2 1835 2477 394180734 394180074 0.000000e+00 1083
25 TraesCS2A01G241300 chr1D 96.369 661 6 2 1835 2477 483921141 483921801 0.000000e+00 1072
26 TraesCS2A01G241300 chr1D 100.000 74 0 0 1 74 51877356 51877283 1.190000e-28 137
27 TraesCS2A01G241300 chr1D 98.667 75 0 1 1 74 254417771 254417845 5.560000e-27 132
28 TraesCS2A01G241300 chr3D 98.911 643 7 0 1835 2477 21899355 21898713 0.000000e+00 1149
29 TraesCS2A01G241300 chr4D 98.445 643 10 0 1835 2477 19911779 19911137 0.000000e+00 1133
30 TraesCS2A01G241300 chr7B 100.000 74 0 0 1 74 105255892 105255819 1.190000e-28 137
31 TraesCS2A01G241300 chr5A 100.000 74 0 0 1 74 607199384 607199311 1.190000e-28 137


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2A01G241300 chr2A 335827438 335829914 2476 True 4575.0 4575 100.000 1 2477 1 chr2A.!!$R1 2476
1 TraesCS2A01G241300 chr2A 588083887 588084429 542 True 965.0 965 98.713 1835 2378 1 chr2A.!!$R2 543
2 TraesCS2A01G241300 chrUn 93410683 93412448 1765 False 3073.0 3073 98.131 74 1834 1 chrUn.!!$F1 1760
3 TraesCS2A01G241300 chrUn 317471369 317472029 660 False 1077.0 1077 96.520 1835 2477 1 chrUn.!!$F2 642
4 TraesCS2A01G241300 chr5D 503215400 503217165 1765 True 3061.0 3061 97.963 74 1837 1 chr5D.!!$R2 1763
5 TraesCS2A01G241300 chr5D 329121155 329122925 1770 False 2964.0 2964 96.900 70 1838 1 chr5D.!!$F3 1768
6 TraesCS2A01G241300 chr5D 554197972 554198632 660 True 1077.0 1077 96.520 1835 2477 1 chr5D.!!$R4 642
7 TraesCS2A01G241300 chr5D 554199185 554199843 658 False 1075.0 1075 96.520 1835 2477 1 chr5D.!!$F4 642
8 TraesCS2A01G241300 chr5D 6206006 6206666 660 False 1066.0 1066 96.218 1835 2477 1 chr5D.!!$F1 642
9 TraesCS2A01G241300 chr6D 168248720 168250487 1767 True 3051.0 3051 97.851 74 1837 1 chr6D.!!$R2 1763
10 TraesCS2A01G241300 chr6D 431401183 431404724 3541 True 1088.5 1094 96.823 1835 2477 2 chr6D.!!$R3 642
11 TraesCS2A01G241300 chr6D 431402396 431403056 660 False 1077.0 1077 96.520 1835 2477 1 chr6D.!!$F1 642
12 TraesCS2A01G241300 chr2D 272794946 272796710 1764 False 3051.0 3051 97.905 74 1834 1 chr2D.!!$F1 1760
13 TraesCS2A01G241300 chr3A 672911061 672912824 1763 False 2972.0 2972 97.112 74 1834 1 chr3A.!!$F1 1760
14 TraesCS2A01G241300 chr6A 260117334 260119097 1763 False 2933.0 2933 96.719 74 1834 1 chr6A.!!$F1 1760
15 TraesCS2A01G241300 chr7A 352182865 352184620 1755 False 2687.0 2687 94.274 74 1834 1 chr7A.!!$F1 1760
16 TraesCS2A01G241300 chr1D 397109208 397110839 1631 False 2636.0 2636 95.790 198 1834 1 chr1D.!!$F2 1636
17 TraesCS2A01G241300 chr1D 394180074 394180734 660 True 1083.0 1083 96.672 1835 2477 1 chr1D.!!$R2 642
18 TraesCS2A01G241300 chr1D 483921141 483921801 660 False 1072.0 1072 96.369 1835 2477 1 chr1D.!!$F3 642
19 TraesCS2A01G241300 chr3D 21898713 21899355 642 True 1149.0 1149 98.911 1835 2477 1 chr3D.!!$R1 642
20 TraesCS2A01G241300 chr4D 19911137 19911779 642 True 1133.0 1133 98.445 1835 2477 1 chr4D.!!$R1 642

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
765 775 1.846007 ATTGGTTTATTCGGCAGCCA 58.154 45.0 13.3 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1609 1635 2.200373 ATTGTTTGGAGGGGAAGTCG 57.8 50.0 0.0 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 9.717942 ATCTTGGAGATTATGTAATGCTTACTC 57.282 33.333 7.33 0.00 32.41 2.59
39 40 8.928448 TCTTGGAGATTATGTAATGCTTACTCT 58.072 33.333 0.00 3.06 37.06 3.24
40 41 9.202273 CTTGGAGATTATGTAATGCTTACTCTC 57.798 37.037 0.00 10.88 37.06 3.20
41 42 8.250143 TGGAGATTATGTAATGCTTACTCTCA 57.750 34.615 16.05 0.00 36.31 3.27
42 43 8.704668 TGGAGATTATGTAATGCTTACTCTCAA 58.295 33.333 16.05 8.85 36.31 3.02
43 44 9.547753 GGAGATTATGTAATGCTTACTCTCAAA 57.452 33.333 16.05 4.92 36.31 2.69
50 51 9.683069 ATGTAATGCTTACTCTCAAACTTTTTG 57.317 29.630 7.33 0.00 37.06 2.44
51 52 8.682710 TGTAATGCTTACTCTCAAACTTTTTGT 58.317 29.630 7.33 0.00 37.06 2.83
52 53 9.516314 GTAATGCTTACTCTCAAACTTTTTGTT 57.484 29.630 0.00 0.00 35.39 2.83
85 86 9.661187 GTAGTGATATTCTTTACTTCGATCGAA 57.339 33.333 27.54 27.54 0.00 3.71
119 120 7.451566 ACATAGAATGCCACTCTTTAAAAAGGT 59.548 33.333 2.77 0.00 36.67 3.50
126 129 7.842982 TGCCACTCTTTAAAAAGGTAAAAAGT 58.157 30.769 2.77 0.00 36.67 2.66
494 504 3.503800 AGGCGGGGAATAACCTTATTC 57.496 47.619 8.68 8.68 45.16 1.75
599 609 5.047802 TCCAACCGATCGTCTACTTAAGTTT 60.048 40.000 14.49 0.00 0.00 2.66
746 756 6.826668 TCGAGCATCTTATCCCATCTTAAAA 58.173 36.000 0.00 0.00 0.00 1.52
765 775 1.846007 ATTGGTTTATTCGGCAGCCA 58.154 45.000 13.30 0.00 0.00 4.75
866 880 2.086054 AGAAATTCAGACGCGAGCTT 57.914 45.000 15.93 0.00 0.00 3.74
875 889 2.430921 CGCGAGCTTGAGGACGTT 60.431 61.111 4.70 0.00 0.00 3.99
1110 1132 7.792364 TTCTGAAGGTCTACAGGAAGATAAA 57.208 36.000 0.00 0.00 35.20 1.40
1185 1207 9.046296 GGCTCGAATAGAAAAATAGAATCAGAA 57.954 33.333 0.00 0.00 0.00 3.02
1255 1277 7.359262 TCAAGTTCCGAAGTAATTACACATG 57.641 36.000 17.65 8.87 0.00 3.21
1568 1594 2.536761 AAAATTGTGGGTCGTCTCGA 57.463 45.000 0.00 0.00 0.00 4.04
1609 1635 4.554134 GCGCCGAATCTATTAAAAAGGGTC 60.554 45.833 0.00 0.00 0.00 4.46
1641 1667 4.162812 TCCAAACAATTCGCGCTAAAATC 58.837 39.130 5.56 0.00 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 9.516314 AACAAAAAGTTTGAGAGTAAGCATTAC 57.484 29.630 7.68 0.00 44.43 1.89
56 57 9.953697 GATCGAAGTAAAGAATATCACTACTGT 57.046 33.333 0.00 0.00 0.00 3.55
57 58 9.108449 CGATCGAAGTAAAGAATATCACTACTG 57.892 37.037 10.26 0.00 0.00 2.74
58 59 9.053840 TCGATCGAAGTAAAGAATATCACTACT 57.946 33.333 16.99 0.00 0.00 2.57
59 60 9.661187 TTCGATCGAAGTAAAGAATATCACTAC 57.339 33.333 25.96 0.00 0.00 2.73
61 62 9.751542 ATTTCGATCGAAGTAAAGAATATCACT 57.248 29.630 27.68 0.00 35.38 3.41
67 68 9.542462 TCCAATATTTCGATCGAAGTAAAGAAT 57.458 29.630 29.18 20.64 35.38 2.40
68 69 8.814235 GTCCAATATTTCGATCGAAGTAAAGAA 58.186 33.333 29.18 15.88 35.38 2.52
71 72 8.657074 ATGTCCAATATTTCGATCGAAGTAAA 57.343 30.769 29.18 17.51 35.38 2.01
85 86 6.845908 AGAGTGGCATTCTATGTCCAATATT 58.154 36.000 11.16 0.00 37.89 1.28
119 120 7.115805 CGTGTCACAGCTGATTACTACTTTTTA 59.884 37.037 23.35 0.00 0.00 1.52
126 129 4.776795 TTCGTGTCACAGCTGATTACTA 57.223 40.909 23.35 3.20 0.00 1.82
281 285 8.924511 ATATGTTCCTTTCCATTATGAATCGT 57.075 30.769 0.00 0.00 0.00 3.73
599 609 5.895636 TTTGTGCTTTGAAAACTCTCTCA 57.104 34.783 0.00 0.00 0.00 3.27
746 756 1.476488 GTGGCTGCCGAATAAACCAAT 59.524 47.619 14.98 0.00 0.00 3.16
765 775 9.646522 AAAATCCCTATAATGAGTAGCATTTGT 57.353 29.630 0.00 0.00 44.68 2.83
866 880 2.222885 TGGGGAAACAACGTCCTCA 58.777 52.632 0.00 0.00 43.67 3.86
1185 1207 9.661563 TTATGTGTAATTACTTCGGAACTTGAT 57.338 29.630 16.33 0.00 0.00 2.57
1255 1277 9.422196 CGTATCGATTTCTTTTTGGATTTCTAC 57.578 33.333 1.71 0.00 0.00 2.59
1568 1594 2.393764 CGCGTGCAATTTCTTTTCCTT 58.606 42.857 0.00 0.00 0.00 3.36
1609 1635 2.200373 ATTGTTTGGAGGGGAAGTCG 57.800 50.000 0.00 0.00 0.00 4.18
1641 1667 5.319139 CGAATTGGATAGCAGCAATAATCG 58.681 41.667 0.00 0.00 0.00 3.34
1993 4902 3.006940 TCTATGGTTTGGTGCTTTAGCG 58.993 45.455 0.00 0.00 45.83 4.26
2300 5209 8.905660 TCTATCTATATATAGAACCCTCGTGC 57.094 38.462 23.08 0.00 42.20 5.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.